Incidental Mutation 'R5463:Dclk3'
ID 433108
Institutional Source Beutler Lab
Gene Symbol Dclk3
Ensembl Gene ENSMUSG00000032500
Gene Name doublecortin-like kinase 3
Synonyms Dcamkl3, Click-I, -II related
MMRRC Submission 043025-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.189) question?
Stock # R5463 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 111268149-111318186 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 111298328 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 624 (V624A)
Ref Sequence ENSEMBL: ENSMUSP00000107510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111879]
AlphaFold Q8BWQ5
Predicted Effect probably benign
Transcript: ENSMUST00000111879
AA Change: V624A

PolyPhen 2 Score 0.260 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107510
Gene: ENSMUSG00000032500
AA Change: V624A

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
Pfam:DCX 115 177 2.9e-17 PFAM
low complexity region 200 218 N/A INTRINSIC
low complexity region 267 277 N/A INTRINSIC
low complexity region 479 496 N/A INTRINSIC
S_TKc 514 771 1.63e-110 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the protein kinase superfamily and the doublecortin family. Differently from the other two closely related family members (DCLK1 and DCLK2), the protein encoded by this gene contains only one N-terminal doublecortin domain and is unable to bind microtubules and to regulate microtubule polymerization. The protein contains a C-terminal serine/threonine protein kinase domain, which shows substantial homology to Ca2+/calmoduline-dependent protein kinase, and a serine/proline-rich domain in between the doublecortin and the protein kinase domains, which mediates multiple protein-protein interactions. [provided by RefSeq, Sep 2010]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik A C 10: 115,406,104 (GRCm39) probably benign Het
Arhgap29 T A 3: 121,782,200 (GRCm39) S71T possibly damaging Het
BC048507 T C 13: 68,011,817 (GRCm39) Y65H probably damaging Het
C3 T C 17: 57,518,720 (GRCm39) E1221G probably benign Het
Calb1 G T 4: 15,885,656 (GRCm39) V76L probably benign Het
Crybg1 T A 10: 43,879,689 (GRCm39) K500* probably null Het
Csmd1 G A 8: 16,034,860 (GRCm39) T2437I probably benign Het
Cyp27b1 G A 10: 126,887,966 (GRCm39) V493I possibly damaging Het
Cyp3a44 T A 5: 145,740,554 (GRCm39) T29S probably benign Het
Dnah6 T C 6: 73,069,140 (GRCm39) I2464V probably benign Het
Dock6 A T 9: 21,721,254 (GRCm39) probably null Het
Erap1 C T 13: 74,794,533 (GRCm39) T64I probably damaging Het
Erbb3 A T 10: 128,405,948 (GRCm39) Y1156* probably null Het
Fam168a G A 7: 100,484,602 (GRCm39) A231T probably benign Het
Farp1 C T 14: 121,472,489 (GRCm39) P208L probably damaging Het
Fbxo30 T C 10: 11,166,813 (GRCm39) Y512H probably damaging Het
Gcnt2 A T 13: 41,071,650 (GRCm39) I98F possibly damaging Het
Got1 G A 19: 43,493,036 (GRCm39) T295I probably benign Het
Herc2 A G 7: 55,844,010 (GRCm39) E3538G probably damaging Het
Kcnmb4 A T 10: 116,309,410 (GRCm39) V6E probably benign Het
Kmt2d G A 15: 98,749,990 (GRCm39) probably benign Het
Letmd1 C T 15: 100,367,009 (GRCm39) A2V probably damaging Het
Lynx1 G T 15: 74,623,462 (GRCm39) Y28* probably null Het
Mast1 T C 8: 85,652,136 (GRCm39) E304G probably damaging Het
Nipa1 G A 7: 55,629,205 (GRCm39) Q303* probably null Het
Nomo1 G A 7: 45,712,426 (GRCm39) R657H possibly damaging Het
Or51b4 C T 7: 103,530,541 (GRCm39) R303H probably benign Het
Pcdha7 T A 18: 37,108,628 (GRCm39) L551Q probably damaging Het
Pik3r4 T C 9: 105,525,930 (GRCm39) Y267H probably damaging Het
Pnliprp1 A G 19: 58,723,168 (GRCm39) D223G probably damaging Het
Prph G A 15: 98,953,281 (GRCm39) G65D probably benign Het
Pskh1 T C 8: 106,639,464 (GRCm39) L48P probably benign Het
Ptdss1 C A 13: 67,093,365 (GRCm39) N68K probably damaging Het
Rexo5 G A 7: 119,433,526 (GRCm39) G495R probably damaging Het
Ryr1 C A 7: 28,723,448 (GRCm39) A4204S possibly damaging Het
Serpinb9 G A 13: 33,199,659 (GRCm39) S318N probably damaging Het
Slc22a8 G A 19: 8,586,638 (GRCm39) R383H probably benign Het
Trim26 A G 17: 37,162,016 (GRCm39) H145R probably damaging Het
Trps1 A T 15: 50,695,286 (GRCm39) Y286* probably null Het
Vmn1r181 A G 7: 23,683,787 (GRCm39) N84S probably benign Het
Wdfy4 G T 14: 32,873,689 (GRCm39) Q207K probably benign Het
Whrn G A 4: 63,351,053 (GRCm39) T427I probably benign Het
Other mutations in Dclk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02027:Dclk3 APN 9 111,296,911 (GRCm39) nonsense probably null
IGL02125:Dclk3 APN 9 111,298,175 (GRCm39) missense probably damaging 1.00
IGL02547:Dclk3 APN 9 111,298,091 (GRCm39) missense probably damaging 1.00
IGL03393:Dclk3 APN 9 111,317,741 (GRCm39) utr 3 prime probably benign
G1citation:Dclk3 UTSW 9 111,268,405 (GRCm39) missense probably benign 0.03
IGL02984:Dclk3 UTSW 9 111,317,643 (GRCm39) missense probably damaging 1.00
R0109:Dclk3 UTSW 9 111,296,738 (GRCm39) missense possibly damaging 0.93
R0109:Dclk3 UTSW 9 111,296,738 (GRCm39) missense possibly damaging 0.93
R0238:Dclk3 UTSW 9 111,311,696 (GRCm39) missense probably damaging 0.99
R0238:Dclk3 UTSW 9 111,311,696 (GRCm39) missense probably damaging 0.99
R0432:Dclk3 UTSW 9 111,314,003 (GRCm39) missense probably damaging 1.00
R0440:Dclk3 UTSW 9 111,298,231 (GRCm39) missense probably damaging 1.00
R0530:Dclk3 UTSW 9 111,311,789 (GRCm39) missense probably damaging 1.00
R1024:Dclk3 UTSW 9 111,298,138 (GRCm39) missense possibly damaging 0.95
R1443:Dclk3 UTSW 9 111,298,088 (GRCm39) missense probably benign 0.01
R1474:Dclk3 UTSW 9 111,298,304 (GRCm39) missense probably benign 0.43
R1479:Dclk3 UTSW 9 111,297,614 (GRCm39) missense probably benign
R1482:Dclk3 UTSW 9 111,296,888 (GRCm39) missense possibly damaging 0.90
R1543:Dclk3 UTSW 9 111,297,122 (GRCm39) missense probably benign 0.04
R1552:Dclk3 UTSW 9 111,317,647 (GRCm39) missense probably damaging 1.00
R1559:Dclk3 UTSW 9 111,298,276 (GRCm39) missense probably damaging 1.00
R2011:Dclk3 UTSW 9 111,297,422 (GRCm39) missense probably benign 0.00
R2369:Dclk3 UTSW 9 111,317,610 (GRCm39) missense probably benign 0.16
R4111:Dclk3 UTSW 9 111,298,148 (GRCm39) missense probably damaging 0.99
R4510:Dclk3 UTSW 9 111,297,060 (GRCm39) missense probably benign 0.01
R4511:Dclk3 UTSW 9 111,297,060 (GRCm39) missense probably benign 0.01
R4592:Dclk3 UTSW 9 111,296,963 (GRCm39) missense probably damaging 1.00
R4604:Dclk3 UTSW 9 111,298,253 (GRCm39) missense probably damaging 1.00
R4857:Dclk3 UTSW 9 111,297,716 (GRCm39) missense probably benign
R4932:Dclk3 UTSW 9 111,297,110 (GRCm39) missense possibly damaging 0.56
R5045:Dclk3 UTSW 9 111,296,856 (GRCm39) missense probably damaging 0.99
R5233:Dclk3 UTSW 9 111,297,749 (GRCm39) missense probably benign
R5338:Dclk3 UTSW 9 111,298,127 (GRCm39) missense possibly damaging 0.95
R6822:Dclk3 UTSW 9 111,268,405 (GRCm39) missense probably benign 0.03
R6995:Dclk3 UTSW 9 111,296,768 (GRCm39) missense possibly damaging 0.88
R7187:Dclk3 UTSW 9 111,314,064 (GRCm39) missense probably damaging 1.00
R7532:Dclk3 UTSW 9 111,296,596 (GRCm39) missense probably benign 0.03
R7534:Dclk3 UTSW 9 111,297,286 (GRCm39) missense probably benign
R7734:Dclk3 UTSW 9 111,298,163 (GRCm39) missense probably damaging 1.00
R8326:Dclk3 UTSW 9 111,296,602 (GRCm39) missense probably damaging 0.96
R8372:Dclk3 UTSW 9 111,314,081 (GRCm39) missense probably damaging 0.98
R8388:Dclk3 UTSW 9 111,311,813 (GRCm39) missense probably damaging 1.00
R8423:Dclk3 UTSW 9 111,297,787 (GRCm39) missense possibly damaging 0.93
R8493:Dclk3 UTSW 9 111,297,215 (GRCm39) missense probably benign 0.06
R9013:Dclk3 UTSW 9 111,297,566 (GRCm39) missense probably benign 0.31
R9114:Dclk3 UTSW 9 111,317,683 (GRCm39) missense probably benign 0.06
R9338:Dclk3 UTSW 9 111,268,373 (GRCm39) missense unknown
R9412:Dclk3 UTSW 9 111,311,819 (GRCm39) critical splice donor site probably null
R9701:Dclk3 UTSW 9 111,298,244 (GRCm39) missense probably damaging 1.00
R9776:Dclk3 UTSW 9 111,298,226 (GRCm39) missense probably damaging 1.00
R9802:Dclk3 UTSW 9 111,298,244 (GRCm39) missense probably damaging 1.00
X0020:Dclk3 UTSW 9 111,314,143 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTCTCATCCCAACATTGTGAA -3'
(R):5'- TTCTTGAACATAAAGGTTAACACAGTG -3'

Sequencing Primer
(F):5'- CATTGTGAAACTGCACGAGGTCTAC -3'
(R):5'- CCTTACAGCTGGATCTCATAGAGG -3'
Posted On 2016-10-06