Incidental Mutation 'R5463:Crybg1'
ID 433110
Institutional Source Beutler Lab
Gene Symbol Crybg1
Ensembl Gene ENSMUSG00000019866
Gene Name crystallin beta-gamma domain containing 1
Synonyms Aim1
MMRRC Submission 043025-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5463 (G1)
Quality Score 187
Status Not validated
Chromosome 10
Chromosomal Location 43826632-44024849 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 43879689 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 500 (K500*)
Ref Sequence ENSEMBL: ENSMUSP00000143429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020017] [ENSMUST00000200401]
AlphaFold A0A0G2JG52
Predicted Effect probably null
Transcript: ENSMUST00000020017
AA Change: K126*
SMART Domains Protein: ENSMUSP00000020017
Gene: ENSMUSG00000019866
AA Change: K126*

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 114 121 N/A INTRINSIC
low complexity region 176 192 N/A INTRINSIC
low complexity region 436 453 N/A INTRINSIC
low complexity region 507 518 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 837 857 N/A INTRINSIC
XTALbg 995 1078 8.57e-9 SMART
XTALbg 1094 1175 4.73e-20 SMART
XTALbg 1189 1282 1.23e-32 SMART
XTALbg 1290 1373 9.3e-28 SMART
XTALbg 1386 1465 1.66e-24 SMART
XTALbg 1473 1553 5.29e-32 SMART
RICIN 1556 1689 5.86e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000099864
Predicted Effect probably null
Transcript: ENSMUST00000200401
AA Change: K500*
SMART Domains Protein: ENSMUSP00000143429
Gene: ENSMUSG00000019866
AA Change: K500*

DomainStartEndE-ValueType
low complexity region 377 390 N/A INTRINSIC
low complexity region 488 495 N/A INTRINSIC
low complexity region 550 566 N/A INTRINSIC
low complexity region 810 827 N/A INTRINSIC
low complexity region 881 892 N/A INTRINSIC
low complexity region 918 931 N/A INTRINSIC
low complexity region 1211 1231 N/A INTRINSIC
XTALbg 1369 1452 5.4e-11 SMART
XTALbg 1468 1549 2.9e-22 SMART
XTALbg 1563 1656 7.9e-35 SMART
XTALbg 1664 1747 6e-30 SMART
XTALbg 1760 1839 1.1e-26 SMART
XTALbg 1847 1927 3.3e-34 SMART
RICIN 1930 2063 3.3e-17 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik A C 10: 115,406,104 (GRCm39) probably benign Het
Arhgap29 T A 3: 121,782,200 (GRCm39) S71T possibly damaging Het
BC048507 T C 13: 68,011,817 (GRCm39) Y65H probably damaging Het
C3 T C 17: 57,518,720 (GRCm39) E1221G probably benign Het
Calb1 G T 4: 15,885,656 (GRCm39) V76L probably benign Het
Csmd1 G A 8: 16,034,860 (GRCm39) T2437I probably benign Het
Cyp27b1 G A 10: 126,887,966 (GRCm39) V493I possibly damaging Het
Cyp3a44 T A 5: 145,740,554 (GRCm39) T29S probably benign Het
Dclk3 T C 9: 111,298,328 (GRCm39) V624A probably benign Het
Dnah6 T C 6: 73,069,140 (GRCm39) I2464V probably benign Het
Dock6 A T 9: 21,721,254 (GRCm39) probably null Het
Erap1 C T 13: 74,794,533 (GRCm39) T64I probably damaging Het
Erbb3 A T 10: 128,405,948 (GRCm39) Y1156* probably null Het
Fam168a G A 7: 100,484,602 (GRCm39) A231T probably benign Het
Farp1 C T 14: 121,472,489 (GRCm39) P208L probably damaging Het
Fbxo30 T C 10: 11,166,813 (GRCm39) Y512H probably damaging Het
Gcnt2 A T 13: 41,071,650 (GRCm39) I98F possibly damaging Het
Got1 G A 19: 43,493,036 (GRCm39) T295I probably benign Het
Herc2 A G 7: 55,844,010 (GRCm39) E3538G probably damaging Het
Kcnmb4 A T 10: 116,309,410 (GRCm39) V6E probably benign Het
Kmt2d G A 15: 98,749,990 (GRCm39) probably benign Het
Letmd1 C T 15: 100,367,009 (GRCm39) A2V probably damaging Het
Lynx1 G T 15: 74,623,462 (GRCm39) Y28* probably null Het
Mast1 T C 8: 85,652,136 (GRCm39) E304G probably damaging Het
Nipa1 G A 7: 55,629,205 (GRCm39) Q303* probably null Het
Nomo1 G A 7: 45,712,426 (GRCm39) R657H possibly damaging Het
Or51b4 C T 7: 103,530,541 (GRCm39) R303H probably benign Het
Pcdha7 T A 18: 37,108,628 (GRCm39) L551Q probably damaging Het
Pik3r4 T C 9: 105,525,930 (GRCm39) Y267H probably damaging Het
Pnliprp1 A G 19: 58,723,168 (GRCm39) D223G probably damaging Het
Prph G A 15: 98,953,281 (GRCm39) G65D probably benign Het
Pskh1 T C 8: 106,639,464 (GRCm39) L48P probably benign Het
Ptdss1 C A 13: 67,093,365 (GRCm39) N68K probably damaging Het
Rexo5 G A 7: 119,433,526 (GRCm39) G495R probably damaging Het
Ryr1 C A 7: 28,723,448 (GRCm39) A4204S possibly damaging Het
Serpinb9 G A 13: 33,199,659 (GRCm39) S318N probably damaging Het
Slc22a8 G A 19: 8,586,638 (GRCm39) R383H probably benign Het
Trim26 A G 17: 37,162,016 (GRCm39) H145R probably damaging Het
Trps1 A T 15: 50,695,286 (GRCm39) Y286* probably null Het
Vmn1r181 A G 7: 23,683,787 (GRCm39) N84S probably benign Het
Wdfy4 G T 14: 32,873,689 (GRCm39) Q207K probably benign Het
Whrn G A 4: 63,351,053 (GRCm39) T427I probably benign Het
Other mutations in Crybg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Crybg1 APN 10 43,868,505 (GRCm39) missense probably damaging 1.00
IGL00502:Crybg1 APN 10 43,834,309 (GRCm39) missense probably damaging 1.00
IGL00848:Crybg1 APN 10 43,843,814 (GRCm39) splice site probably null
IGL01287:Crybg1 APN 10 43,868,490 (GRCm39) missense possibly damaging 0.53
IGL01310:Crybg1 APN 10 43,879,596 (GRCm39) missense probably damaging 0.99
IGL01310:Crybg1 APN 10 43,851,054 (GRCm39) missense possibly damaging 0.95
IGL02683:Crybg1 APN 10 43,865,212 (GRCm39) missense possibly damaging 0.64
IGL03095:Crybg1 APN 10 43,865,245 (GRCm39) missense probably damaging 1.00
R0062:Crybg1 UTSW 10 43,873,902 (GRCm39) missense probably damaging 0.98
R0142:Crybg1 UTSW 10 43,875,059 (GRCm39) missense possibly damaging 0.83
R0294:Crybg1 UTSW 10 43,862,372 (GRCm39) missense probably damaging 1.00
R0539:Crybg1 UTSW 10 43,874,894 (GRCm39) missense probably benign 0.03
R0781:Crybg1 UTSW 10 43,875,089 (GRCm39) missense possibly damaging 0.95
R1110:Crybg1 UTSW 10 43,875,089 (GRCm39) missense possibly damaging 0.95
R1189:Crybg1 UTSW 10 43,874,790 (GRCm39) missense probably damaging 1.00
R1428:Crybg1 UTSW 10 43,851,074 (GRCm39) missense probably benign 0.33
R1521:Crybg1 UTSW 10 43,874,412 (GRCm39) missense probably damaging 1.00
R1688:Crybg1 UTSW 10 43,849,794 (GRCm39) missense probably damaging 1.00
R1728:Crybg1 UTSW 10 43,880,015 (GRCm39) missense probably damaging 0.97
R1756:Crybg1 UTSW 10 43,862,275 (GRCm39) missense probably damaging 1.00
R1773:Crybg1 UTSW 10 43,868,544 (GRCm39) missense possibly damaging 0.91
R1784:Crybg1 UTSW 10 43,880,015 (GRCm39) missense probably damaging 0.97
R1850:Crybg1 UTSW 10 43,873,670 (GRCm39) missense probably damaging 1.00
R1911:Crybg1 UTSW 10 43,873,673 (GRCm39) missense possibly damaging 0.47
R1920:Crybg1 UTSW 10 43,873,544 (GRCm39) missense probably damaging 1.00
R1964:Crybg1 UTSW 10 43,834,326 (GRCm39) missense probably damaging 1.00
R2298:Crybg1 UTSW 10 43,875,218 (GRCm39) missense probably damaging 1.00
R3617:Crybg1 UTSW 10 43,832,782 (GRCm39) missense possibly damaging 0.82
R3913:Crybg1 UTSW 10 43,874,759 (GRCm39) missense possibly damaging 0.95
R4081:Crybg1 UTSW 10 43,851,035 (GRCm39) missense probably damaging 1.00
R4116:Crybg1 UTSW 10 43,875,158 (GRCm39) missense possibly damaging 0.91
R4409:Crybg1 UTSW 10 43,874,754 (GRCm39) missense possibly damaging 0.94
R4583:Crybg1 UTSW 10 43,873,616 (GRCm39) missense probably damaging 1.00
R4721:Crybg1 UTSW 10 43,873,883 (GRCm39) missense probably damaging 1.00
R4818:Crybg1 UTSW 10 43,874,583 (GRCm39) missense probably benign 0.00
R4859:Crybg1 UTSW 10 43,868,565 (GRCm39) missense probably damaging 1.00
R4933:Crybg1 UTSW 10 43,875,209 (GRCm39) missense probably damaging 1.00
R5028:Crybg1 UTSW 10 43,874,208 (GRCm39) missense possibly damaging 0.74
R5057:Crybg1 UTSW 10 43,865,104 (GRCm39) nonsense probably null
R5102:Crybg1 UTSW 10 43,873,832 (GRCm39) missense probably damaging 1.00
R5103:Crybg1 UTSW 10 43,873,944 (GRCm39) missense probably damaging 1.00
R5137:Crybg1 UTSW 10 43,834,332 (GRCm39) missense probably damaging 1.00
R5212:Crybg1 UTSW 10 43,843,739 (GRCm39) missense possibly damaging 0.95
R5307:Crybg1 UTSW 10 43,879,710 (GRCm39) missense probably benign 0.00
R5353:Crybg1 UTSW 10 43,849,661 (GRCm39) missense probably damaging 1.00
R5503:Crybg1 UTSW 10 43,874,762 (GRCm39) missense probably benign 0.00
R5583:Crybg1 UTSW 10 43,879,506 (GRCm39) missense probably benign 0.01
R5835:Crybg1 UTSW 10 43,851,129 (GRCm39) missense probably benign 0.28
R6021:Crybg1 UTSW 10 43,873,534 (GRCm39) missense probably damaging 1.00
R6032:Crybg1 UTSW 10 43,832,756 (GRCm39) missense probably damaging 1.00
R6032:Crybg1 UTSW 10 43,832,756 (GRCm39) missense probably damaging 1.00
R6277:Crybg1 UTSW 10 43,873,255 (GRCm39) missense probably benign 0.03
R6338:Crybg1 UTSW 10 43,868,505 (GRCm39) missense probably damaging 1.00
R6348:Crybg1 UTSW 10 43,879,947 (GRCm39) missense probably damaging 1.00
R6514:Crybg1 UTSW 10 43,873,211 (GRCm39) missense probably damaging 1.00
R6785:Crybg1 UTSW 10 43,875,167 (GRCm39) missense probably benign 0.00
R6804:Crybg1 UTSW 10 43,842,337 (GRCm39) missense probably damaging 1.00
R6938:Crybg1 UTSW 10 43,873,379 (GRCm39) missense probably benign 0.01
R6983:Crybg1 UTSW 10 43,875,338 (GRCm39) missense probably damaging 1.00
R7002:Crybg1 UTSW 10 43,874,831 (GRCm39) missense probably damaging 1.00
R7153:Crybg1 UTSW 10 43,840,662 (GRCm39) missense possibly damaging 0.64
R7271:Crybg1 UTSW 10 43,873,619 (GRCm39) nonsense probably null
R7293:Crybg1 UTSW 10 43,879,428 (GRCm39) missense probably damaging 1.00
R7304:Crybg1 UTSW 10 43,873,254 (GRCm39) missense probably benign 0.05
R7313:Crybg1 UTSW 10 43,865,107 (GRCm39) missense probably damaging 0.98
R7373:Crybg1 UTSW 10 43,880,136 (GRCm39) missense probably benign 0.00
R7449:Crybg1 UTSW 10 43,880,515 (GRCm39) missense probably benign
R7530:Crybg1 UTSW 10 43,875,069 (GRCm39) missense possibly damaging 0.62
R7660:Crybg1 UTSW 10 43,874,831 (GRCm39) missense probably damaging 0.97
R7701:Crybg1 UTSW 10 43,865,139 (GRCm39) missense probably benign 0.06
R8181:Crybg1 UTSW 10 43,862,322 (GRCm39) missense probably damaging 0.98
R8237:Crybg1 UTSW 10 43,842,376 (GRCm39) nonsense probably null
R8359:Crybg1 UTSW 10 43,868,538 (GRCm39) missense probably benign 0.03
R8751:Crybg1 UTSW 10 43,880,838 (GRCm39) missense probably benign 0.04
R8809:Crybg1 UTSW 10 43,879,428 (GRCm39) missense probably damaging 1.00
R9017:Crybg1 UTSW 10 43,880,477 (GRCm39) missense probably benign 0.00
R9069:Crybg1 UTSW 10 43,874,103 (GRCm39) missense probably benign 0.30
R9099:Crybg1 UTSW 10 43,874,844 (GRCm39) missense probably benign 0.01
R9118:Crybg1 UTSW 10 43,879,925 (GRCm39) missense possibly damaging 0.56
R9185:Crybg1 UTSW 10 43,880,091 (GRCm39) missense probably benign 0.04
R9486:Crybg1 UTSW 10 43,880,145 (GRCm39) start gained probably benign
R9561:Crybg1 UTSW 10 43,873,428 (GRCm39) missense probably benign 0.00
RF005:Crybg1 UTSW 10 43,880,741 (GRCm39) missense probably benign 0.03
RF024:Crybg1 UTSW 10 43,880,741 (GRCm39) missense probably benign 0.03
X0065:Crybg1 UTSW 10 43,868,522 (GRCm39) synonymous silent
Z1088:Crybg1 UTSW 10 43,873,307 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTTTGGTGGTCACAGTAGAC -3'
(R):5'- GAAATCGGTACAAGCGGTTCC -3'

Sequencing Primer
(F):5'- AACTGGTTCCTGGGCTTCAG -3'
(R):5'- GGTTCCCGACGGAGGCG -3'
Posted On 2016-10-06