Incidental Mutation 'R5463:Erbb3'
ID433114
Institutional Source Beutler Lab
Gene Symbol Erbb3
Ensembl Gene ENSMUSG00000018166
Gene Nameerb-b2 receptor tyrosine kinase 3
SynonymsErbb-3, Erbb3r, HER3
MMRRC Submission 043025-MU
Accession Numbers

Ncbi RefSeq: NM_010153.1; MGI:95411

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5463 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location128567523-128589652 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 128570079 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 1156 (Y1156*)
Ref Sequence ENSEMBL: ENSMUSP00000080716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026425] [ENSMUST00000082059] [ENSMUST00000131728]
Predicted Effect probably benign
Transcript: ENSMUST00000026425
SMART Domains Protein: ENSMUSP00000026425
Gene: ENSMUSG00000025364

DomainStartEndE-ValueType
Pfam:Peptidase_M24 19 293 2.1e-27 PFAM
low complexity region 359 377 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000082059
AA Change: Y1156*
SMART Domains Protein: ENSMUSP00000080716
Gene: ENSMUSG00000018166
AA Change: Y1156*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 2.4e-31 PFAM
FU 180 220 5.83e0 SMART
FU 223 265 7.63e-10 SMART
Pfam:Recep_L_domain 353 474 7.5e-33 PFAM
FU 490 541 7.82e-7 SMART
FU 546 595 1.34e-5 SMART
FU 607 643 9.24e0 SMART
TyrKc 707 963 7.42e-91 SMART
low complexity region 997 1018 N/A INTRINSIC
low complexity region 1113 1124 N/A INTRINSIC
low complexity region 1135 1148 N/A INTRINSIC
low complexity region 1172 1185 N/A INTRINSIC
low complexity region 1186 1196 N/A INTRINSIC
low complexity region 1201 1213 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131728
SMART Domains Protein: ENSMUSP00000114434
Gene: ENSMUSG00000025364

DomainStartEndE-ValueType
Pfam:Peptidase_M24 19 232 1.2e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147068
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype Strain: 3513098; 1929072; 1928828; 1929598
Lethality: E10-E14
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the epidermal growth factor receptor (EGFR) family of receptor tyrosine kinases. This membrane-bound protein has a neuregulin binding domain but not an active kinase domain. It therefore can bind this ligand but not convey the signal into the cell through protein phosphorylation. However, it does form heterodimers with other EGF receptor family members which do have kinase activity. Heterodimerization leads to the activation of pathways which lead to cell proliferation or differentiation. Amplification of this gene and/or overexpression of its protein have been reported in numerous cancers, including prostate, bladder, and breast tumors. Alternate transcriptional splice variants encoding different isoforms have been characterized. One isoform lacks the intermembrane region and is secreted outside the cell. This form acts to modulate the activity of the membrane-bound form. Additional splice variants have also been reported, but they have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a lack of Schwann-cell precursors leading to loss of sensory and motor neurons, hypoplasia of the primary sympathetic ganglion chain, cardiac defects, impaired brain development, and embryonic lethality. [provided by MGI curators]
Allele List at MGI

All alleles(27) : Targeted(11) Gene trapped(14) Chemically induced(2)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik A C 10: 115,570,199 probably benign Het
Arhgap29 T A 3: 121,988,551 S71T possibly damaging Het
BC048507 T C 13: 67,863,698 Y65H probably damaging Het
C3 T C 17: 57,211,720 E1221G probably benign Het
Calb1 G T 4: 15,885,656 V76L probably benign Het
Crybg1 T A 10: 44,003,693 K500* probably null Het
Csmd1 G A 8: 15,984,860 T2437I probably benign Het
Cyp27b1 G A 10: 127,052,097 V493I possibly damaging Het
Cyp3a44 T A 5: 145,803,744 T29S probably benign Het
Dclk3 T C 9: 111,469,260 V624A probably benign Het
Dnah6 T C 6: 73,092,157 I2464V probably benign Het
Dock6 A T 9: 21,809,958 probably null Het
Erap1 C T 13: 74,646,414 T64I probably damaging Het
Fam168a G A 7: 100,835,395 A231T probably benign Het
Farp1 C T 14: 121,235,077 P208L probably damaging Het
Fbxo30 T C 10: 11,291,069 Y512H probably damaging Het
Gcnt2 A T 13: 40,918,174 I98F possibly damaging Het
Got1 G A 19: 43,504,597 T295I probably benign Het
Herc2 A G 7: 56,194,262 E3538G probably damaging Het
Kcnmb4 A T 10: 116,473,505 V6E probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Letmd1 C T 15: 100,469,128 A2V probably damaging Het
Lynx1 G T 15: 74,751,613 Y28* probably null Het
Mast1 T C 8: 84,925,507 E304G probably damaging Het
Nipa1 G A 7: 55,979,457 Q303* probably null Het
Nomo1 G A 7: 46,063,002 R657H possibly damaging Het
Olfr66 C T 7: 103,881,334 R303H probably benign Het
Pcdha7 T A 18: 36,975,575 L551Q probably damaging Het
Pik3r4 T C 9: 105,648,731 Y267H probably damaging Het
Pnliprp1 A G 19: 58,734,736 D223G probably damaging Het
Prph G A 15: 99,055,400 G65D probably benign Het
Pskh1 T C 8: 105,912,832 L48P probably benign Het
Ptdss1 C A 13: 66,945,301 N68K probably damaging Het
Rexo5 G A 7: 119,834,303 G495R probably damaging Het
Ryr1 C A 7: 29,024,023 A4204S possibly damaging Het
Serpinb9 G A 13: 33,015,676 S318N probably damaging Het
Slc22a8 G A 19: 8,609,274 R383H probably benign Het
Trim26 A G 17: 36,851,124 H145R probably damaging Het
Trps1 A T 15: 50,831,890 Y286* probably null Het
Vmn1r181 A G 7: 23,984,362 N84S probably benign Het
Wdfy4 G T 14: 33,151,732 Q207K probably benign Het
Whrn G A 4: 63,432,816 T427I probably benign Het
Other mutations in Erbb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Erbb3 APN 10 128570983 missense probably damaging 0.99
IGL01482:Erbb3 APN 10 128572929 missense possibly damaging 0.87
IGL01866:Erbb3 APN 10 128569368 makesense probably null
IGL01981:Erbb3 APN 10 128571650 missense probably benign 0.28
IGL02190:Erbb3 APN 10 128571010 splice site probably null
IGL02329:Erbb3 APN 10 128573219 missense probably damaging 1.00
IGL02400:Erbb3 APN 10 128579524 missense probably benign 0.02
IGL02478:Erbb3 APN 10 128571358 nonsense probably null
IGL02502:Erbb3 APN 10 128570284 missense probably benign
IGL02539:Erbb3 APN 10 128584305 splice site probably null
IGL03187:Erbb3 APN 10 128572594 splice site probably benign
I1329:Erbb3 UTSW 10 128583454 missense possibly damaging 0.73
PIT4812001:Erbb3 UTSW 10 128574379 missense possibly damaging 0.67
R0006:Erbb3 UTSW 10 128573410 critical splice donor site probably null
R0006:Erbb3 UTSW 10 128573410 critical splice donor site probably null
R0078:Erbb3 UTSW 10 128583441 missense probably damaging 1.00
R0366:Erbb3 UTSW 10 128572570 missense possibly damaging 0.77
R0601:Erbb3 UTSW 10 128577012 missense probably benign 0.01
R0621:Erbb3 UTSW 10 128586225 missense probably benign 0.00
R1222:Erbb3 UTSW 10 128571665 missense probably damaging 1.00
R1675:Erbb3 UTSW 10 128571204 missense probably damaging 0.97
R1676:Erbb3 UTSW 10 128583248 missense probably benign 0.08
R1692:Erbb3 UTSW 10 128571725 missense probably benign 0.19
R1875:Erbb3 UTSW 10 128574466 missense possibly damaging 0.71
R2002:Erbb3 UTSW 10 128586225 missense probably benign 0.00
R2219:Erbb3 UTSW 10 128569871 missense probably damaging 0.99
R2328:Erbb3 UTSW 10 128583693 missense probably damaging 1.00
R3840:Erbb3 UTSW 10 128570324 missense probably benign
R4393:Erbb3 UTSW 10 128572770 missense probably damaging 1.00
R4567:Erbb3 UTSW 10 128579075 missense probably damaging 1.00
R4616:Erbb3 UTSW 10 128572770 nonsense probably null
R4766:Erbb3 UTSW 10 128586238 missense possibly damaging 0.76
R4881:Erbb3 UTSW 10 128576947 missense probably benign 0.00
R4974:Erbb3 UTSW 10 128572448 missense probably benign
R5266:Erbb3 UTSW 10 128569636 missense probably damaging 1.00
R5481:Erbb3 UTSW 10 128572480 missense probably damaging 0.98
R5997:Erbb3 UTSW 10 128583185 missense probably damaging 1.00
R6370:Erbb3 UTSW 10 128570074 missense possibly damaging 0.90
R7639:Erbb3 UTSW 10 128569847 missense probably damaging 0.99
R7713:Erbb3 UTSW 10 128574449 missense probably benign
R7847:Erbb3 UTSW 10 128571189 missense probably damaging 1.00
R7930:Erbb3 UTSW 10 128571189 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAACTGAGACCTACTGACG -3'
(R):5'- TCTGAGGCTGAACTCCAAGAG -3'

Sequencing Primer
(F):5'- TACTGACGAAAGGGTGCCTTC -3'
(R):5'- GCTGAACTCCAAGAGAGAGTATC -3'
Posted On2016-10-06