Incidental Mutation 'R5463:Erbb3'
ID 433114
Institutional Source Beutler Lab
Gene Symbol Erbb3
Ensembl Gene ENSMUSG00000018166
Gene Name erb-b2 receptor tyrosine kinase 3
Synonyms Erbb3r, Erbb-3, HER3
MMRRC Submission 043025-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5463 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 128403392-128425504 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 128405948 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 1156 (Y1156*)
Ref Sequence ENSEMBL: ENSMUSP00000080716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026425] [ENSMUST00000082059] [ENSMUST00000131728]
AlphaFold Q61526
Predicted Effect probably benign
Transcript: ENSMUST00000026425
SMART Domains Protein: ENSMUSP00000026425
Gene: ENSMUSG00000025364

DomainStartEndE-ValueType
Pfam:Peptidase_M24 19 293 2.1e-27 PFAM
low complexity region 359 377 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000082059
AA Change: Y1156*
SMART Domains Protein: ENSMUSP00000080716
Gene: ENSMUSG00000018166
AA Change: Y1156*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 2.4e-31 PFAM
FU 180 220 5.83e0 SMART
FU 223 265 7.63e-10 SMART
Pfam:Recep_L_domain 353 474 7.5e-33 PFAM
FU 490 541 7.82e-7 SMART
FU 546 595 1.34e-5 SMART
FU 607 643 9.24e0 SMART
TyrKc 707 963 7.42e-91 SMART
low complexity region 997 1018 N/A INTRINSIC
low complexity region 1113 1124 N/A INTRINSIC
low complexity region 1135 1148 N/A INTRINSIC
low complexity region 1172 1185 N/A INTRINSIC
low complexity region 1186 1196 N/A INTRINSIC
low complexity region 1201 1213 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131728
SMART Domains Protein: ENSMUSP00000114434
Gene: ENSMUSG00000025364

DomainStartEndE-ValueType
Pfam:Peptidase_M24 19 232 1.2e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147068
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the epidermal growth factor receptor (EGFR) family of receptor tyrosine kinases. This membrane-bound protein has a neuregulin binding domain but not an active kinase domain. It therefore can bind this ligand but not convey the signal into the cell through protein phosphorylation. However, it does form heterodimers with other EGF receptor family members which do have kinase activity. Heterodimerization leads to the activation of pathways which lead to cell proliferation or differentiation. Amplification of this gene and/or overexpression of its protein have been reported in numerous cancers, including prostate, bladder, and breast tumors. Alternate transcriptional splice variants encoding different isoforms have been characterized. One isoform lacks the intermembrane region and is secreted outside the cell. This form acts to modulate the activity of the membrane-bound form. Additional splice variants have also been reported, but they have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a lack of Schwann-cell precursors leading to loss of sensory and motor neurons, hypoplasia of the primary sympathetic ganglion chain, cardiac defects, impaired brain development, and embryonic lethality. [provided by MGI curators]
Allele List at MGI

All alleles(27) : Targeted(11) Gene trapped(14) Chemically induced(2)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik A C 10: 115,406,104 (GRCm39) probably benign Het
Arhgap29 T A 3: 121,782,200 (GRCm39) S71T possibly damaging Het
BC048507 T C 13: 68,011,817 (GRCm39) Y65H probably damaging Het
C3 T C 17: 57,518,720 (GRCm39) E1221G probably benign Het
Calb1 G T 4: 15,885,656 (GRCm39) V76L probably benign Het
Crybg1 T A 10: 43,879,689 (GRCm39) K500* probably null Het
Csmd1 G A 8: 16,034,860 (GRCm39) T2437I probably benign Het
Cyp27b1 G A 10: 126,887,966 (GRCm39) V493I possibly damaging Het
Cyp3a44 T A 5: 145,740,554 (GRCm39) T29S probably benign Het
Dclk3 T C 9: 111,298,328 (GRCm39) V624A probably benign Het
Dnah6 T C 6: 73,069,140 (GRCm39) I2464V probably benign Het
Dock6 A T 9: 21,721,254 (GRCm39) probably null Het
Erap1 C T 13: 74,794,533 (GRCm39) T64I probably damaging Het
Fam168a G A 7: 100,484,602 (GRCm39) A231T probably benign Het
Farp1 C T 14: 121,472,489 (GRCm39) P208L probably damaging Het
Fbxo30 T C 10: 11,166,813 (GRCm39) Y512H probably damaging Het
Gcnt2 A T 13: 41,071,650 (GRCm39) I98F possibly damaging Het
Got1 G A 19: 43,493,036 (GRCm39) T295I probably benign Het
Herc2 A G 7: 55,844,010 (GRCm39) E3538G probably damaging Het
Kcnmb4 A T 10: 116,309,410 (GRCm39) V6E probably benign Het
Kmt2d G A 15: 98,749,990 (GRCm39) probably benign Het
Letmd1 C T 15: 100,367,009 (GRCm39) A2V probably damaging Het
Lynx1 G T 15: 74,623,462 (GRCm39) Y28* probably null Het
Mast1 T C 8: 85,652,136 (GRCm39) E304G probably damaging Het
Nipa1 G A 7: 55,629,205 (GRCm39) Q303* probably null Het
Nomo1 G A 7: 45,712,426 (GRCm39) R657H possibly damaging Het
Or51b4 C T 7: 103,530,541 (GRCm39) R303H probably benign Het
Pcdha7 T A 18: 37,108,628 (GRCm39) L551Q probably damaging Het
Pik3r4 T C 9: 105,525,930 (GRCm39) Y267H probably damaging Het
Pnliprp1 A G 19: 58,723,168 (GRCm39) D223G probably damaging Het
Prph G A 15: 98,953,281 (GRCm39) G65D probably benign Het
Pskh1 T C 8: 106,639,464 (GRCm39) L48P probably benign Het
Ptdss1 C A 13: 67,093,365 (GRCm39) N68K probably damaging Het
Rexo5 G A 7: 119,433,526 (GRCm39) G495R probably damaging Het
Ryr1 C A 7: 28,723,448 (GRCm39) A4204S possibly damaging Het
Serpinb9 G A 13: 33,199,659 (GRCm39) S318N probably damaging Het
Slc22a8 G A 19: 8,586,638 (GRCm39) R383H probably benign Het
Trim26 A G 17: 37,162,016 (GRCm39) H145R probably damaging Het
Trps1 A T 15: 50,695,286 (GRCm39) Y286* probably null Het
Vmn1r181 A G 7: 23,683,787 (GRCm39) N84S probably benign Het
Wdfy4 G T 14: 32,873,689 (GRCm39) Q207K probably benign Het
Whrn G A 4: 63,351,053 (GRCm39) T427I probably benign Het
Other mutations in Erbb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Erbb3 APN 10 128,406,852 (GRCm39) missense probably damaging 0.99
IGL01482:Erbb3 APN 10 128,408,798 (GRCm39) missense possibly damaging 0.87
IGL01866:Erbb3 APN 10 128,405,237 (GRCm39) makesense probably null
IGL01981:Erbb3 APN 10 128,407,519 (GRCm39) missense probably benign 0.28
IGL02190:Erbb3 APN 10 128,406,879 (GRCm39) splice site probably null
IGL02329:Erbb3 APN 10 128,409,088 (GRCm39) missense probably damaging 1.00
IGL02400:Erbb3 APN 10 128,415,393 (GRCm39) missense probably benign 0.02
IGL02478:Erbb3 APN 10 128,407,227 (GRCm39) nonsense probably null
IGL02502:Erbb3 APN 10 128,406,153 (GRCm39) missense probably benign
IGL02539:Erbb3 APN 10 128,420,174 (GRCm39) splice site probably null
IGL03187:Erbb3 APN 10 128,408,463 (GRCm39) splice site probably benign
I1329:Erbb3 UTSW 10 128,419,323 (GRCm39) missense possibly damaging 0.73
PIT4812001:Erbb3 UTSW 10 128,410,248 (GRCm39) missense possibly damaging 0.67
R0006:Erbb3 UTSW 10 128,409,279 (GRCm39) critical splice donor site probably null
R0006:Erbb3 UTSW 10 128,409,279 (GRCm39) critical splice donor site probably null
R0078:Erbb3 UTSW 10 128,419,310 (GRCm39) missense probably damaging 1.00
R0366:Erbb3 UTSW 10 128,408,439 (GRCm39) missense possibly damaging 0.77
R0601:Erbb3 UTSW 10 128,412,881 (GRCm39) missense probably benign 0.01
R0621:Erbb3 UTSW 10 128,422,094 (GRCm39) missense probably benign 0.00
R1222:Erbb3 UTSW 10 128,407,534 (GRCm39) missense probably damaging 1.00
R1675:Erbb3 UTSW 10 128,407,073 (GRCm39) missense probably damaging 0.97
R1676:Erbb3 UTSW 10 128,419,117 (GRCm39) missense probably benign 0.08
R1692:Erbb3 UTSW 10 128,407,594 (GRCm39) missense probably benign 0.19
R1875:Erbb3 UTSW 10 128,410,335 (GRCm39) missense possibly damaging 0.71
R2002:Erbb3 UTSW 10 128,422,094 (GRCm39) missense probably benign 0.00
R2219:Erbb3 UTSW 10 128,405,740 (GRCm39) missense probably damaging 0.99
R2328:Erbb3 UTSW 10 128,419,562 (GRCm39) missense probably damaging 1.00
R3840:Erbb3 UTSW 10 128,406,193 (GRCm39) missense probably benign
R4393:Erbb3 UTSW 10 128,408,639 (GRCm39) missense probably damaging 1.00
R4567:Erbb3 UTSW 10 128,414,944 (GRCm39) missense probably damaging 1.00
R4616:Erbb3 UTSW 10 128,408,639 (GRCm39) nonsense probably null
R4766:Erbb3 UTSW 10 128,422,107 (GRCm39) missense possibly damaging 0.76
R4881:Erbb3 UTSW 10 128,412,816 (GRCm39) missense probably benign 0.00
R4974:Erbb3 UTSW 10 128,408,317 (GRCm39) missense probably benign
R5266:Erbb3 UTSW 10 128,405,505 (GRCm39) missense probably damaging 1.00
R5481:Erbb3 UTSW 10 128,408,349 (GRCm39) missense probably damaging 0.98
R5997:Erbb3 UTSW 10 128,419,054 (GRCm39) missense probably damaging 1.00
R6370:Erbb3 UTSW 10 128,405,943 (GRCm39) missense possibly damaging 0.90
R7639:Erbb3 UTSW 10 128,405,716 (GRCm39) missense probably damaging 0.99
R7713:Erbb3 UTSW 10 128,410,318 (GRCm39) missense probably benign
R7847:Erbb3 UTSW 10 128,407,058 (GRCm39) missense probably damaging 1.00
R8529:Erbb3 UTSW 10 128,419,069 (GRCm39) missense probably damaging 0.99
R8843:Erbb3 UTSW 10 128,414,325 (GRCm39) missense possibly damaging 0.82
R8988:Erbb3 UTSW 10 128,406,030 (GRCm39) missense probably damaging 1.00
R9336:Erbb3 UTSW 10 128,420,929 (GRCm39) missense probably benign 0.15
R9530:Erbb3 UTSW 10 128,410,291 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGAACTGAGACCTACTGACG -3'
(R):5'- TCTGAGGCTGAACTCCAAGAG -3'

Sequencing Primer
(F):5'- TACTGACGAAAGGGTGCCTTC -3'
(R):5'- GCTGAACTCCAAGAGAGAGTATC -3'
Posted On 2016-10-06