Incidental Mutation 'R5463:Gcnt2'
ID 433117
Institutional Source Beutler Lab
Gene Symbol Gcnt2
Ensembl Gene ENSMUSG00000021360
Gene Name glucosaminyl (N-acetyl) transferase 2 (I blood group)
Synonyms 5330430K10Rik, IGnTB, IGnT, IGnTA, IGnTC
MMRRC Submission 043025-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.113) question?
Stock # R5463 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 41013417-41114368 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 41071650 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 98 (I98F)
Ref Sequence ENSEMBL: ENSMUSP00000066467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067778] [ENSMUST00000069958] [ENSMUST00000110191] [ENSMUST00000225759]
AlphaFold P97402
Predicted Effect possibly damaging
Transcript: ENSMUST00000067778
AA Change: I98F

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000066467
Gene: ENSMUSG00000021360
AA Change: I98F

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Branch 95 357 4.2e-58 PFAM
low complexity region 377 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069958
SMART Domains Protein: ENSMUSP00000070942
Gene: ENSMUSG00000021360

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
Pfam:Branch 95 357 8.4e-60 PFAM
low complexity region 377 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110191
SMART Domains Protein: ENSMUSP00000105820
Gene: ENSMUSG00000021360

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
Pfam:Branch 95 357 5.2e-61 PFAM
low complexity region 377 386 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224935
Predicted Effect probably benign
Transcript: ENSMUST00000225759
AA Change: I98F

PolyPhen 2 Score 0.427 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme responsible for formation of the blood group I antigen. The i and I antigens are distinguished by linear and branched poly-N-acetyllactosaminoglycans, respectively. The encoded protein is the I-branching enzyme, a beta-1,6-N-acetylglucosaminyltransferase responsible for the conversion of fetal i antigen to adult I antigen in erythrocytes during embryonic development. Mutations in this gene have been associated with adult i blood group phenotype. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show hypoactivity, a reduced B cell number, epidermoid cyst formation in male abdominal skin, and impaired renal function with increased blood urea nitrogen and creatinine levels and vacuolization of renal tubular epithelial cells in aging mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik A C 10: 115,406,104 (GRCm39) probably benign Het
Arhgap29 T A 3: 121,782,200 (GRCm39) S71T possibly damaging Het
BC048507 T C 13: 68,011,817 (GRCm39) Y65H probably damaging Het
C3 T C 17: 57,518,720 (GRCm39) E1221G probably benign Het
Calb1 G T 4: 15,885,656 (GRCm39) V76L probably benign Het
Crybg1 T A 10: 43,879,689 (GRCm39) K500* probably null Het
Csmd1 G A 8: 16,034,860 (GRCm39) T2437I probably benign Het
Cyp27b1 G A 10: 126,887,966 (GRCm39) V493I possibly damaging Het
Cyp3a44 T A 5: 145,740,554 (GRCm39) T29S probably benign Het
Dclk3 T C 9: 111,298,328 (GRCm39) V624A probably benign Het
Dnah6 T C 6: 73,069,140 (GRCm39) I2464V probably benign Het
Dock6 A T 9: 21,721,254 (GRCm39) probably null Het
Erap1 C T 13: 74,794,533 (GRCm39) T64I probably damaging Het
Erbb3 A T 10: 128,405,948 (GRCm39) Y1156* probably null Het
Fam168a G A 7: 100,484,602 (GRCm39) A231T probably benign Het
Farp1 C T 14: 121,472,489 (GRCm39) P208L probably damaging Het
Fbxo30 T C 10: 11,166,813 (GRCm39) Y512H probably damaging Het
Got1 G A 19: 43,493,036 (GRCm39) T295I probably benign Het
Herc2 A G 7: 55,844,010 (GRCm39) E3538G probably damaging Het
Kcnmb4 A T 10: 116,309,410 (GRCm39) V6E probably benign Het
Kmt2d G A 15: 98,749,990 (GRCm39) probably benign Het
Letmd1 C T 15: 100,367,009 (GRCm39) A2V probably damaging Het
Lynx1 G T 15: 74,623,462 (GRCm39) Y28* probably null Het
Mast1 T C 8: 85,652,136 (GRCm39) E304G probably damaging Het
Nipa1 G A 7: 55,629,205 (GRCm39) Q303* probably null Het
Nomo1 G A 7: 45,712,426 (GRCm39) R657H possibly damaging Het
Or51b4 C T 7: 103,530,541 (GRCm39) R303H probably benign Het
Pcdha7 T A 18: 37,108,628 (GRCm39) L551Q probably damaging Het
Pik3r4 T C 9: 105,525,930 (GRCm39) Y267H probably damaging Het
Pnliprp1 A G 19: 58,723,168 (GRCm39) D223G probably damaging Het
Prph G A 15: 98,953,281 (GRCm39) G65D probably benign Het
Pskh1 T C 8: 106,639,464 (GRCm39) L48P probably benign Het
Ptdss1 C A 13: 67,093,365 (GRCm39) N68K probably damaging Het
Rexo5 G A 7: 119,433,526 (GRCm39) G495R probably damaging Het
Ryr1 C A 7: 28,723,448 (GRCm39) A4204S possibly damaging Het
Serpinb9 G A 13: 33,199,659 (GRCm39) S318N probably damaging Het
Slc22a8 G A 19: 8,586,638 (GRCm39) R383H probably benign Het
Trim26 A G 17: 37,162,016 (GRCm39) H145R probably damaging Het
Trps1 A T 15: 50,695,286 (GRCm39) Y286* probably null Het
Vmn1r181 A G 7: 23,683,787 (GRCm39) N84S probably benign Het
Wdfy4 G T 14: 32,873,689 (GRCm39) Q207K probably benign Het
Whrn G A 4: 63,351,053 (GRCm39) T427I probably benign Het
Other mutations in Gcnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01523:Gcnt2 APN 13 41,041,339 (GRCm39) missense probably benign 0.06
IGL01693:Gcnt2 APN 13 41,041,549 (GRCm39) missense probably benign
IGL02506:Gcnt2 APN 13 41,040,856 (GRCm39) missense probably benign 0.02
IGL03184:Gcnt2 APN 13 41,041,660 (GRCm39) missense probably benign 0.01
BB001:Gcnt2 UTSW 13 41,072,040 (GRCm39) nonsense probably null
BB011:Gcnt2 UTSW 13 41,072,040 (GRCm39) nonsense probably null
PIT4472001:Gcnt2 UTSW 13 41,071,413 (GRCm39) missense probably benign 0.39
R0358:Gcnt2 UTSW 13 41,014,329 (GRCm39) missense probably damaging 0.99
R0734:Gcnt2 UTSW 13 41,013,997 (GRCm39) missense probably benign 0.00
R1863:Gcnt2 UTSW 13 41,014,577 (GRCm39) missense possibly damaging 0.95
R3103:Gcnt2 UTSW 13 41,072,082 (GRCm39) missense probably benign 0.00
R3156:Gcnt2 UTSW 13 41,014,654 (GRCm39) missense probably benign 0.36
R3893:Gcnt2 UTSW 13 41,013,922 (GRCm39) missense probably benign 0.14
R4134:Gcnt2 UTSW 13 41,041,283 (GRCm39) missense probably damaging 1.00
R4135:Gcnt2 UTSW 13 41,041,283 (GRCm39) missense probably damaging 1.00
R4279:Gcnt2 UTSW 13 41,041,666 (GRCm39) missense probably benign 0.17
R4422:Gcnt2 UTSW 13 41,014,001 (GRCm39) nonsense probably null
R4599:Gcnt2 UTSW 13 41,040,966 (GRCm39) missense probably benign
R4618:Gcnt2 UTSW 13 41,111,670 (GRCm39) nonsense probably null
R4908:Gcnt2 UTSW 13 41,014,210 (GRCm39) missense probably damaging 1.00
R5123:Gcnt2 UTSW 13 41,071,831 (GRCm39) missense probably damaging 0.99
R5291:Gcnt2 UTSW 13 41,072,268 (GRCm39) missense probably damaging 1.00
R5437:Gcnt2 UTSW 13 41,014,652 (GRCm39) missense probably damaging 1.00
R5471:Gcnt2 UTSW 13 41,014,195 (GRCm39) missense probably damaging 1.00
R5472:Gcnt2 UTSW 13 41,107,055 (GRCm39) missense probably benign 0.30
R5493:Gcnt2 UTSW 13 41,107,076 (GRCm39) missense possibly damaging 0.70
R5586:Gcnt2 UTSW 13 41,014,429 (GRCm39) missense probably damaging 1.00
R5695:Gcnt2 UTSW 13 41,071,675 (GRCm39) missense probably benign 0.03
R6244:Gcnt2 UTSW 13 41,014,717 (GRCm39) missense probably damaging 1.00
R6293:Gcnt2 UTSW 13 41,072,173 (GRCm39) missense probably damaging 1.00
R7036:Gcnt2 UTSW 13 41,041,032 (GRCm39) frame shift probably null
R7077:Gcnt2 UTSW 13 41,013,896 (GRCm39) missense probably benign
R7432:Gcnt2 UTSW 13 41,040,688 (GRCm39) intron probably benign
R7474:Gcnt2 UTSW 13 41,111,733 (GRCm39) missense probably damaging 1.00
R7508:Gcnt2 UTSW 13 41,041,157 (GRCm39) missense probably benign 0.02
R7599:Gcnt2 UTSW 13 41,014,343 (GRCm39) nonsense probably null
R7678:Gcnt2 UTSW 13 41,107,195 (GRCm39) missense probably benign 0.01
R7806:Gcnt2 UTSW 13 41,071,717 (GRCm39) missense probably damaging 1.00
R7808:Gcnt2 UTSW 13 41,014,338 (GRCm39) missense possibly damaging 0.81
R7909:Gcnt2 UTSW 13 41,013,926 (GRCm39) missense probably benign 0.00
R7924:Gcnt2 UTSW 13 41,072,040 (GRCm39) nonsense probably null
R8110:Gcnt2 UTSW 13 41,071,198 (GRCm39) start gained probably benign
R8287:Gcnt2 UTSW 13 41,014,108 (GRCm39) missense probably damaging 1.00
R8782:Gcnt2 UTSW 13 41,072,229 (GRCm39) missense probably damaging 0.98
R8956:Gcnt2 UTSW 13 41,041,204 (GRCm39) missense probably benign 0.30
R9225:Gcnt2 UTSW 13 41,014,336 (GRCm39) missense probably damaging 1.00
R9357:Gcnt2 UTSW 13 41,041,732 (GRCm39) missense possibly damaging 0.92
Z1088:Gcnt2 UTSW 13 41,072,115 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACGTCTGTCACCATCTGTG -3'
(R):5'- CACCAGATCTTTCATGCAGTTC -3'

Sequencing Primer
(F):5'- CTGTGATTACGGCTTGCAAAATC -3'
(R):5'- ATGCAGTTCAGATCAGCCTG -3'
Posted On 2016-10-06