Incidental Mutation 'R5463:Erap1'
ID433120
Institutional Source Beutler Lab
Gene Symbol Erap1
Ensembl Gene ENSMUSG00000021583
Gene Nameendoplasmic reticulum aminopeptidase 1
SynonymsERAAP, Arts1, PILSAP
MMRRC Submission 043025-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R5463 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location74639568-74693201 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 74646414 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 64 (T64I)
Ref Sequence ENSEMBL: ENSMUSP00000152462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169114] [ENSMUST00000221526] [ENSMUST00000221822]
Predicted Effect probably benign
Transcript: ENSMUST00000169114
AA Change: T64I

PolyPhen 2 Score 0.309 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000133166
Gene: ENSMUSG00000021583
AA Change: T64I

DomainStartEndE-ValueType
Pfam:Peptidase_M1 42 430 2.7e-135 PFAM
low complexity region 488 501 N/A INTRINSIC
Pfam:ERAP1_C 586 904 1.7e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220594
Predicted Effect probably damaging
Transcript: ENSMUST00000221526
AA Change: T64I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000221822
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an aminopeptidase involved in trimming HLA class I-binding precursors so that they can be presented on MHC class I molecules. The encoded protein acts as a monomer or as a heterodimer with ERAP2. This protein may also be involved in blood pressure regulation by inactivation of angiotensin II. Three transcript variants encoding two different isoforms have been found for this gene.[provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a targeted mutation may exhibit extramedullary hematopoiesis of the spleen, thymus hyperplasia, or enlarged kidneys at older ages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik A C 10: 115,570,199 probably benign Het
Arhgap29 T A 3: 121,988,551 S71T possibly damaging Het
BC048507 T C 13: 67,863,698 Y65H probably damaging Het
C3 T C 17: 57,211,720 E1221G probably benign Het
Calb1 G T 4: 15,885,656 V76L probably benign Het
Crybg1 T A 10: 44,003,693 K500* probably null Het
Csmd1 G A 8: 15,984,860 T2437I probably benign Het
Cyp27b1 G A 10: 127,052,097 V493I possibly damaging Het
Cyp3a44 T A 5: 145,803,744 T29S probably benign Het
Dclk3 T C 9: 111,469,260 V624A probably benign Het
Dnah6 T C 6: 73,092,157 I2464V probably benign Het
Dock6 A T 9: 21,809,958 probably null Het
Erbb3 A T 10: 128,570,079 Y1156* probably null Het
Fam168a G A 7: 100,835,395 A231T probably benign Het
Farp1 C T 14: 121,235,077 P208L probably damaging Het
Fbxo30 T C 10: 11,291,069 Y512H probably damaging Het
Gcnt2 A T 13: 40,918,174 I98F possibly damaging Het
Got1 G A 19: 43,504,597 T295I probably benign Het
Herc2 A G 7: 56,194,262 E3538G probably damaging Het
Kcnmb4 A T 10: 116,473,505 V6E probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Letmd1 C T 15: 100,469,128 A2V probably damaging Het
Lynx1 G T 15: 74,751,613 Y28* probably null Het
Mast1 T C 8: 84,925,507 E304G probably damaging Het
Nipa1 G A 7: 55,979,457 Q303* probably null Het
Nomo1 G A 7: 46,063,002 R657H possibly damaging Het
Olfr66 C T 7: 103,881,334 R303H probably benign Het
Pcdha7 T A 18: 36,975,575 L551Q probably damaging Het
Pik3r4 T C 9: 105,648,731 Y267H probably damaging Het
Pnliprp1 A G 19: 58,734,736 D223G probably damaging Het
Prph G A 15: 99,055,400 G65D probably benign Het
Pskh1 T C 8: 105,912,832 L48P probably benign Het
Ptdss1 C A 13: 66,945,301 N68K probably damaging Het
Rexo5 G A 7: 119,834,303 G495R probably damaging Het
Ryr1 C A 7: 29,024,023 A4204S possibly damaging Het
Serpinb9 G A 13: 33,015,676 S318N probably damaging Het
Slc22a8 G A 19: 8,609,274 R383H probably benign Het
Trim26 A G 17: 36,851,124 H145R probably damaging Het
Trps1 A T 15: 50,831,890 Y286* probably null Het
Vmn1r181 A G 7: 23,984,362 N84S probably benign Het
Wdfy4 G T 14: 33,151,732 Q207K probably benign Het
Whrn G A 4: 63,432,816 T427I probably benign Het
Other mutations in Erap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Erap1 APN 13 74673659 missense probably benign 0.17
IGL00661:Erap1 APN 13 74674789 unclassified probably benign
IGL00903:Erap1 APN 13 74673707 missense probably benign
IGL01095:Erap1 APN 13 74668094 missense probably benign 0.04
IGL01536:Erap1 APN 13 74662423 nonsense probably null
IGL01646:Erap1 APN 13 74666172 missense probably damaging 1.00
IGL01674:Erap1 APN 13 74664231 unclassified probably benign
IGL01795:Erap1 APN 13 74666090 splice site probably null
IGL01922:Erap1 APN 13 74662387 missense probably damaging 1.00
IGL01951:Erap1 APN 13 74675295 missense probably damaging 0.99
IGL02106:Erap1 APN 13 74646639 missense probably benign
IGL02369:Erap1 APN 13 74666526 missense probably benign 0.05
IGL02669:Erap1 APN 13 74675868 missense probably benign 0.13
IGL02866:Erap1 APN 13 74667999 missense probably damaging 0.96
IGL03093:Erap1 APN 13 74675280 missense probably benign 0.10
IGL03265:Erap1 APN 13 74664127 missense probably damaging 1.00
R0091:Erap1 UTSW 13 74668052 missense possibly damaging 0.88
R0456:Erap1 UTSW 13 74664220 missense probably benign 0.24
R0556:Erap1 UTSW 13 74660325 missense probably damaging 1.00
R0627:Erap1 UTSW 13 74675814 unclassified probably benign
R0825:Erap1 UTSW 13 74674614 unclassified probably benign
R1123:Erap1 UTSW 13 74673643 missense probably benign
R1530:Erap1 UTSW 13 74646543 missense probably benign 0.06
R1619:Erap1 UTSW 13 74671381 missense probably damaging 1.00
R1731:Erap1 UTSW 13 74666122 nonsense probably null
R1944:Erap1 UTSW 13 74646639 missense probably benign
R2016:Erap1 UTSW 13 74664151 missense probably damaging 1.00
R2022:Erap1 UTSW 13 74666508 missense probably benign 0.08
R2023:Erap1 UTSW 13 74666508 missense probably benign 0.08
R2045:Erap1 UTSW 13 74669450 missense probably benign 0.01
R2081:Erap1 UTSW 13 74675307 missense possibly damaging 0.67
R2187:Erap1 UTSW 13 74662405 missense probably damaging 0.98
R2198:Erap1 UTSW 13 74646687 missense probably damaging 0.97
R3938:Erap1 UTSW 13 74668028 missense probably damaging 1.00
R4052:Erap1 UTSW 13 74675340 missense probably benign 0.13
R4062:Erap1 UTSW 13 74663536 missense probably benign 0.02
R4128:Erap1 UTSW 13 74666196 missense probably damaging 1.00
R4247:Erap1 UTSW 13 74675295 missense probably damaging 0.99
R4562:Erap1 UTSW 13 74673659 missense probably benign 0.21
R4691:Erap1 UTSW 13 74673692 missense probably damaging 0.99
R4831:Erap1 UTSW 13 74690647 missense probably damaging 1.00
R4916:Erap1 UTSW 13 74646528 missense probably benign
R4983:Erap1 UTSW 13 74690710 missense probably benign 0.01
R5213:Erap1 UTSW 13 74671495 splice site probably null
R5229:Erap1 UTSW 13 74660375 missense possibly damaging 0.94
R5367:Erap1 UTSW 13 74646561 missense probably damaging 0.99
R5566:Erap1 UTSW 13 74662412 missense probably damaging 1.00
R5972:Erap1 UTSW 13 74662304 splice site probably null
R6112:Erap1 UTSW 13 74646279 missense probably benign 0.44
R6132:Erap1 UTSW 13 74660282 missense probably benign 0.00
R6180:Erap1 UTSW 13 74666226 missense possibly damaging 0.55
R6314:Erap1 UTSW 13 74674775 missense probably damaging 0.99
R6479:Erap1 UTSW 13 74663493 splice site probably null
R6919:Erap1 UTSW 13 74671433 missense probably benign 0.20
R7199:Erap1 UTSW 13 74666139 missense probably benign 0.10
R7283:Erap1 UTSW 13 74673784 splice site probably null
R7543:Erap1 UTSW 13 74674634 missense probably damaging 1.00
R8174:Erap1 UTSW 13 74646564 missense probably benign 0.09
R8217:Erap1 UTSW 13 74672818 missense probably benign 0.33
R8320:Erap1 UTSW 13 74666549 missense probably benign 0.02
X0067:Erap1 UTSW 13 74660372 missense probably damaging 1.00
Z1176:Erap1 UTSW 13 74657638 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGTGTCTCTGCTCCTCAAATAG -3'
(R):5'- GCAGTGCAACTTGCTCATGAG -3'

Sequencing Primer
(F):5'- AATAGCCACTTGCAAGCATG -3'
(R):5'- TGAGCAGGATATTCCAGGACCTTC -3'
Posted On2016-10-06