Incidental Mutation 'R5463:Lynx1'
ID 433124
Institutional Source Beutler Lab
Gene Symbol Lynx1
Ensembl Gene ENSMUSG00000022594
Gene Name Ly6/neurotoxin 1
Synonyms
MMRRC Submission 043025-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5463 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 74619705-74624828 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 74623462 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 28 (Y28*)
Ref Sequence ENSEMBL: ENSMUSP00000139494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023259] [ENSMUST00000057932] [ENSMUST00000189128]
AlphaFold P0DP60
Predicted Effect probably null
Transcript: ENSMUST00000023259
AA Change: Y28*
SMART Domains Protein: ENSMUSP00000023259
Gene: ENSMUSG00000022594
AA Change: Y28*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LU 21 104 4.78e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057932
SMART Domains Protein: ENSMUSP00000051457
Gene: ENSMUSG00000075605

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
LU 23 95 4.44e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000189128
AA Change: Y28*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189696
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ly-6/neurotoxin gene family, a group of lymphocyte antigens that attach to the cell surface by a glycosylphosphatidylinositol anchor and have a unique structure showing conserved 8-10 cysteine residues with a characteristic spacing pattern. Functional analysis indicates that this protein is not a ligand or neurotransmitter but has the capacity to enhance nicotinic acetylcholine receptor function in the presence of acetylcholine. This gene may also play a role in the pathogenesis of psoriasis vulgaris. Alternatively spliced variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased sensitivity to nicotine, neurodegeneration, brain vacuoles amd improved cue-conditioned learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik A C 10: 115,406,104 (GRCm39) probably benign Het
Arhgap29 T A 3: 121,782,200 (GRCm39) S71T possibly damaging Het
BC048507 T C 13: 68,011,817 (GRCm39) Y65H probably damaging Het
C3 T C 17: 57,518,720 (GRCm39) E1221G probably benign Het
Calb1 G T 4: 15,885,656 (GRCm39) V76L probably benign Het
Crybg1 T A 10: 43,879,689 (GRCm39) K500* probably null Het
Csmd1 G A 8: 16,034,860 (GRCm39) T2437I probably benign Het
Cyp27b1 G A 10: 126,887,966 (GRCm39) V493I possibly damaging Het
Cyp3a44 T A 5: 145,740,554 (GRCm39) T29S probably benign Het
Dclk3 T C 9: 111,298,328 (GRCm39) V624A probably benign Het
Dnah6 T C 6: 73,069,140 (GRCm39) I2464V probably benign Het
Dock6 A T 9: 21,721,254 (GRCm39) probably null Het
Erap1 C T 13: 74,794,533 (GRCm39) T64I probably damaging Het
Erbb3 A T 10: 128,405,948 (GRCm39) Y1156* probably null Het
Fam168a G A 7: 100,484,602 (GRCm39) A231T probably benign Het
Farp1 C T 14: 121,472,489 (GRCm39) P208L probably damaging Het
Fbxo30 T C 10: 11,166,813 (GRCm39) Y512H probably damaging Het
Gcnt2 A T 13: 41,071,650 (GRCm39) I98F possibly damaging Het
Got1 G A 19: 43,493,036 (GRCm39) T295I probably benign Het
Herc2 A G 7: 55,844,010 (GRCm39) E3538G probably damaging Het
Kcnmb4 A T 10: 116,309,410 (GRCm39) V6E probably benign Het
Kmt2d G A 15: 98,749,990 (GRCm39) probably benign Het
Letmd1 C T 15: 100,367,009 (GRCm39) A2V probably damaging Het
Mast1 T C 8: 85,652,136 (GRCm39) E304G probably damaging Het
Nipa1 G A 7: 55,629,205 (GRCm39) Q303* probably null Het
Nomo1 G A 7: 45,712,426 (GRCm39) R657H possibly damaging Het
Or51b4 C T 7: 103,530,541 (GRCm39) R303H probably benign Het
Pcdha7 T A 18: 37,108,628 (GRCm39) L551Q probably damaging Het
Pik3r4 T C 9: 105,525,930 (GRCm39) Y267H probably damaging Het
Pnliprp1 A G 19: 58,723,168 (GRCm39) D223G probably damaging Het
Prph G A 15: 98,953,281 (GRCm39) G65D probably benign Het
Pskh1 T C 8: 106,639,464 (GRCm39) L48P probably benign Het
Ptdss1 C A 13: 67,093,365 (GRCm39) N68K probably damaging Het
Rexo5 G A 7: 119,433,526 (GRCm39) G495R probably damaging Het
Ryr1 C A 7: 28,723,448 (GRCm39) A4204S possibly damaging Het
Serpinb9 G A 13: 33,199,659 (GRCm39) S318N probably damaging Het
Slc22a8 G A 19: 8,586,638 (GRCm39) R383H probably benign Het
Trim26 A G 17: 37,162,016 (GRCm39) H145R probably damaging Het
Trps1 A T 15: 50,695,286 (GRCm39) Y286* probably null Het
Vmn1r181 A G 7: 23,683,787 (GRCm39) N84S probably benign Het
Wdfy4 G T 14: 32,873,689 (GRCm39) Q207K probably benign Het
Whrn G A 4: 63,351,053 (GRCm39) T427I probably benign Het
Other mutations in Lynx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02297:Lynx1 APN 15 74,623,491 (GRCm39) missense probably benign 0.27
PIT4366001:Lynx1 UTSW 15 74,623,258 (GRCm39) missense possibly damaging 0.79
R2512:Lynx1 UTSW 15 74,623,169 (GRCm39) missense probably damaging 1.00
R3926:Lynx1 UTSW 15 74,623,205 (GRCm39) missense probably damaging 1.00
R5982:Lynx1 UTSW 15 74,623,264 (GRCm39) missense possibly damaging 0.88
R6375:Lynx1 UTSW 15 74,623,168 (GRCm39) missense probably damaging 1.00
R7128:Lynx1 UTSW 15 74,623,398 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCATCCGGTATGGGGTGAAG -3'
(R):5'- AAGCCTGACCCTGGGAAAAG -3'

Sequencing Primer
(F):5'- TCTGCAGGGGACAGACAC -3'
(R):5'- CTGACCCTGGGAAAAGGTGGG -3'
Posted On 2016-10-06