Incidental Mutation 'R5463:Prph'
ID433126
Institutional Source Beutler Lab
Gene Symbol Prph
Ensembl Gene ENSMUSG00000023484
Gene Nameperipherin
SynonymsPrph1
MMRRC Submission 043025-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R5463 (G1)
Quality Score184
Status Not validated
Chromosome15
Chromosomal Location99055174-99058978 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 99055400 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 65 (G65D)
Ref Sequence ENSEMBL: ENSMUSP00000155294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024249] [ENSMUST00000047104] [ENSMUST00000229268] [ENSMUST00000230021]
Predicted Effect unknown
Transcript: ENSMUST00000024249
AA Change: G65D
SMART Domains Protein: ENSMUSP00000024249
Gene: ENSMUSG00000023484
AA Change: G65D

DomainStartEndE-ValueType
Pfam:Filament_head 19 99 2.7e-18 PFAM
Pfam:Filament 100 410 4.5e-112 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000047104
AA Change: G65D
SMART Domains Protein: ENSMUSP00000049303
Gene: ENSMUSG00000023484
AA Change: G65D

DomainStartEndE-ValueType
Pfam:Filament_head 19 99 3.2e-18 PFAM
Filament 100 442 1.87e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229268
Predicted Effect probably benign
Transcript: ENSMUST00000230021
AA Change: G65D

PolyPhen 2 Score 0.426 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein found in neurons of the peripheral nervous system. The encoded protein is a type III intermediate filament protein with homology to other cytoskeletal proteins such as desmin, and is a different protein that the peripherin found in photoreceptors. Mutations in this gene have been associated with susceptibility to amyotrophic lateral sclerosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice showed no overt phenotype up to 14 months of age. While overall structure, number, and caliber of large myelinated axons was normal, mice had reduced numbers of a small subset of unmelinated sensory axons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik A C 10: 115,570,199 probably benign Het
Arhgap29 T A 3: 121,988,551 S71T possibly damaging Het
BC048507 T C 13: 67,863,698 Y65H probably damaging Het
C3 T C 17: 57,211,720 E1221G probably benign Het
Calb1 G T 4: 15,885,656 V76L probably benign Het
Crybg1 T A 10: 44,003,693 K500* probably null Het
Csmd1 G A 8: 15,984,860 T2437I probably benign Het
Cyp27b1 G A 10: 127,052,097 V493I possibly damaging Het
Cyp3a44 T A 5: 145,803,744 T29S probably benign Het
Dclk3 T C 9: 111,469,260 V624A probably benign Het
Dnah6 T C 6: 73,092,157 I2464V probably benign Het
Dock6 A T 9: 21,809,958 probably null Het
Erap1 C T 13: 74,646,414 T64I probably damaging Het
Erbb3 A T 10: 128,570,079 Y1156* probably null Het
Fam168a G A 7: 100,835,395 A231T probably benign Het
Farp1 C T 14: 121,235,077 P208L probably damaging Het
Fbxo30 T C 10: 11,291,069 Y512H probably damaging Het
Gcnt2 A T 13: 40,918,174 I98F possibly damaging Het
Got1 G A 19: 43,504,597 T295I probably benign Het
Herc2 A G 7: 56,194,262 E3538G probably damaging Het
Kcnmb4 A T 10: 116,473,505 V6E probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Letmd1 C T 15: 100,469,128 A2V probably damaging Het
Lynx1 G T 15: 74,751,613 Y28* probably null Het
Mast1 T C 8: 84,925,507 E304G probably damaging Het
Nipa1 G A 7: 55,979,457 Q303* probably null Het
Nomo1 G A 7: 46,063,002 R657H possibly damaging Het
Olfr66 C T 7: 103,881,334 R303H probably benign Het
Pcdha7 T A 18: 36,975,575 L551Q probably damaging Het
Pik3r4 T C 9: 105,648,731 Y267H probably damaging Het
Pnliprp1 A G 19: 58,734,736 D223G probably damaging Het
Pskh1 T C 8: 105,912,832 L48P probably benign Het
Ptdss1 C A 13: 66,945,301 N68K probably damaging Het
Rexo5 G A 7: 119,834,303 G495R probably damaging Het
Ryr1 C A 7: 29,024,023 A4204S possibly damaging Het
Serpinb9 G A 13: 33,015,676 S318N probably damaging Het
Slc22a8 G A 19: 8,609,274 R383H probably benign Het
Trim26 A G 17: 36,851,124 H145R probably damaging Het
Trps1 A T 15: 50,831,890 Y286* probably null Het
Vmn1r181 A G 7: 23,984,362 N84S probably benign Het
Wdfy4 G T 14: 33,151,732 Q207K probably benign Het
Whrn G A 4: 63,432,816 T427I probably benign Het
Other mutations in Prph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Prph APN 15 99058636 missense possibly damaging 0.88
IGL01472:Prph APN 15 99058593 splice site probably benign
IGL01868:Prph APN 15 99056343 missense probably damaging 1.00
IGL02714:Prph APN 15 99056866 missense probably damaging 1.00
IGL02816:Prph APN 15 99057420 missense probably damaging 0.97
R0242:Prph UTSW 15 99055727 missense probably damaging 1.00
R0396:Prph UTSW 15 99056991 missense probably benign
R0441:Prph UTSW 15 99057438 missense probably damaging 1.00
R2065:Prph UTSW 15 99056133 missense probably damaging 1.00
R2326:Prph UTSW 15 99055282 unclassified probably benign
R3115:Prph UTSW 15 99055456 missense probably damaging 1.00
R4441:Prph UTSW 15 99057124 missense probably damaging 1.00
R4794:Prph UTSW 15 99057427 missense probably damaging 1.00
R5058:Prph UTSW 15 99055232 unclassified probably benign
R6199:Prph UTSW 15 99056832 missense probably benign 0.33
R6242:Prph UTSW 15 99057123 missense probably damaging 0.99
R6502:Prph UTSW 15 99056386 missense probably damaging 1.00
R7356:Prph UTSW 15 99056926 missense probably damaging 1.00
R7818:Prph UTSW 15 99057872 missense probably damaging 1.00
R8353:Prph UTSW 15 99056776 missense probably benign 0.02
Z1177:Prph UTSW 15 99056380 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATTCTAGGCTCCAGCGTTG -3'
(R):5'- CGTTCTGCTGCTCCAAGAAG -3'

Sequencing Primer
(F):5'- ATGCATGCTCTAAGGTAGACC -3'
(R):5'- AAGCGCACCTTCTCGATG -3'
Posted On2016-10-06