Mutagenetix > Incidental Mutations

Incidental Mutation 'R5463:Prph'

433126

Institutional Source

Beutler Lab

Gene Symbol

Prph

Ensembl Gene

ENSMUSG00000023484

Gene Name

peripherin

Synonyms

Prph1

MMRRC Submission

043025-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.083) question?

Stock #

R5463 (G1)

Quality Score

184

Status

Not validated

Chromosome

Chromosomal Location

99055174-99058978 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 99055400 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 65 (G65D)

Ref Sequence

ENSEMBL: ENSMUSP00000155294 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024249] [ENSMUST00000047104] [ENSMUST00000229268] [ENSMUST00000230021]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000024249
AA Change: G65D

SMART Domains

Protein: ENSMUSP00000024249
Gene: ENSMUSG00000023484
AA Change: G65D

Domain	Start	End	E-Value	Type
Pfam:Filament_head	19	99	2.7e-18	PFAM
Pfam:Filament	100	410	4.5e-112	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000047104
AA Change: G65D

SMART Domains

Protein: ENSMUSP00000049303
Gene: ENSMUSG00000023484
AA Change: G65D

Domain	Start	End	E-Value	Type
Pfam:Filament_head	19	99	3.2e-18	PFAM
Filament	100	442	1.87e-135	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000229268

Predicted Effect

probably benign
Transcript: ENSMUST00000230021
AA Change: G65D

PolyPhen 2 Score 0.426 (Sensitivity: 0.89; Specificity: 0.90)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein found in neurons of the peripheral nervous system. The encoded protein is a type III intermediate filament protein with homology to other cytoskeletal proteins such as desmin, and is a different protein that the peripherin found in photoreceptors. Mutations in this gene have been associated with susceptibility to amyotrophic lateral sclerosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice showed no overt phenotype up to 14 months of age. While overall structure, number, and caliber of large myelinated axons was normal, mice had reduced numbers of a small subset of unmelinated sensory axons. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A930009A15Rik	A	C	10: 115,570,199		probably benign	Het
Arhgap29	T	A	3: 121,988,551	S71T	possibly damaging	Het
BC048507	T	C	13: 67,863,698	Y65H	probably damaging	Het
C3	T	C	17: 57,211,720	E1221G	probably benign	Het
Calb1	G	T	4: 15,885,656	V76L	probably benign	Het
Crybg1	T	A	10: 44,003,693	K500*	probably null	Het
Csmd1	G	A	8: 15,984,860	T2437I	probably benign	Het
Cyp27b1	G	A	10: 127,052,097	V493I	possibly damaging	Het
Cyp3a44	T	A	5: 145,803,744	T29S	probably benign	Het
Dclk3	T	C	9: 111,469,260	V624A	probably benign	Het
Dnah6	T	C	6: 73,092,157	I2464V	probably benign	Het
Dock6	A	T	9: 21,809,958		probably null	Het
Erap1	C	T	13: 74,646,414	T64I	probably damaging	Het
Erbb3	A	T	10: 128,570,079	Y1156*	probably null	Het
Fam168a	G	A	7: 100,835,395	A231T	probably benign	Het
Farp1	C	T	14: 121,235,077	P208L	probably damaging	Het
Fbxo30	T	C	10: 11,291,069	Y512H	probably damaging	Het
Gcnt2	A	T	13: 40,918,174	I98F	possibly damaging	Het
Got1	G	A	19: 43,504,597	T295I	probably benign	Het
Herc2	A	G	7: 56,194,262	E3538G	probably damaging	Het
Kcnmb4	A	T	10: 116,473,505	V6E	probably benign	Het
Kmt2d	G	A	15: 98,852,109		probably benign	Het
Letmd1	C	T	15: 100,469,128	A2V	probably damaging	Het
Lynx1	G	T	15: 74,751,613	Y28*	probably null	Het
Mast1	T	C	8: 84,925,507	E304G	probably damaging	Het
Nipa1	G	A	7: 55,979,457	Q303*	probably null	Het
Nomo1	G	A	7: 46,063,002	R657H	possibly damaging	Het
Olfr66	C	T	7: 103,881,334	R303H	probably benign	Het
Pcdha7	T	A	18: 36,975,575	L551Q	probably damaging	Het
Pik3r4	T	C	9: 105,648,731	Y267H	probably damaging	Het
Pnliprp1	A	G	19: 58,734,736	D223G	probably damaging	Het
Pskh1	T	C	8: 105,912,832	L48P	probably benign	Het
Ptdss1	C	A	13: 66,945,301	N68K	probably damaging	Het
Rexo5	G	A	7: 119,834,303	G495R	probably damaging	Het
Ryr1	C	A	7: 29,024,023	A4204S	possibly damaging	Het
Serpinb9	G	A	13: 33,015,676	S318N	probably damaging	Het
Slc22a8	G	A	19: 8,609,274	R383H	probably benign	Het
Trim26	A	G	17: 36,851,124	H145R	probably damaging	Het
Trps1	A	T	15: 50,831,890	Y286*	probably null	Het
Vmn1r181	A	G	7: 23,984,362	N84S	probably benign	Het
Wdfy4	G	T	14: 33,151,732	Q207K	probably benign	Het
Whrn	G	A	4: 63,432,816	T427I	probably benign	Het

Other mutations in Prph

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01323:Prph	APN	15	99058636	missense	possibly damaging	0.88
IGL01472:Prph	APN	15	99058593	splice site	probably benign
IGL01868:Prph	APN	15	99056343	missense	probably damaging	1.00
IGL02714:Prph	APN	15	99056866	missense	probably damaging	1.00
IGL02816:Prph	APN	15	99057420	missense	probably damaging	0.97
R0242:Prph	UTSW	15	99055727	missense	probably damaging	1.00
R0396:Prph	UTSW	15	99056991	missense	probably benign
R0441:Prph	UTSW	15	99057438	missense	probably damaging	1.00
R2065:Prph	UTSW	15	99056133	missense	probably damaging	1.00
R2326:Prph	UTSW	15	99055282	unclassified	probably benign
R3115:Prph	UTSW	15	99055456	missense	probably damaging	1.00
R4441:Prph	UTSW	15	99057124	missense	probably damaging	1.00
R4794:Prph	UTSW	15	99057427	missense	probably damaging	1.00
R5058:Prph	UTSW	15	99055232	unclassified	probably benign
R6199:Prph	UTSW	15	99056832	missense	probably benign	0.33
R6242:Prph	UTSW	15	99057123	missense	probably damaging	0.99
R6502:Prph	UTSW	15	99056386	missense	probably damaging	1.00
R7356:Prph	UTSW	15	99056926	missense	probably damaging	1.00
R7818:Prph	UTSW	15	99057872	missense	probably damaging	1.00
R8353:Prph	UTSW	15	99056776	missense	probably benign	0.02
R8453:Prph	UTSW	15	99056776	missense	probably benign	0.02
R9338:Prph	UTSW	15	99057478	missense	probably damaging	1.00
Z1177:Prph	UTSW	15	99056380	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ATTCTAGGCTCCAGCGTTG -3'
(R):5'- CGTTCTGCTGCTCCAAGAAG -3'

Sequencing Primer
(F):5'- ATGCATGCTCTAAGGTAGACC -3'
(R):5'- AAGCGCACCTTCTCGATG -3'

Posted On

2016-10-06