Incidental Mutation 'R5463:Letmd1'
ID 433127
Institutional Source Beutler Lab
Gene Symbol Letmd1
Ensembl Gene ENSMUSG00000037353
Gene Name LETM1 domain containing 1
Synonyms HCCR1, 1110019O13Rik, HCCR-2
MMRRC Submission 043025-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.103) question?
Stock # R5463 (G1)
Quality Score 203
Status Not validated
Chromosome 15
Chromosomal Location 100366904-100377045 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 100367009 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 2 (A2V)
Ref Sequence ENSEMBL: ENSMUSP00000037546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037001] [ENSMUST00000229012] [ENSMUST00000229648] [ENSMUST00000230294]
AlphaFold Q924L1
Predicted Effect probably damaging
Transcript: ENSMUST00000037001
AA Change: A2V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037546
Gene: ENSMUSG00000037353
AA Change: A2V

DomainStartEndE-ValueType
Pfam:LETM1 78 346 1.5e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180953
Predicted Effect probably damaging
Transcript: ENSMUST00000229012
AA Change: A2V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229596
Predicted Effect probably benign
Transcript: ENSMUST00000229648
Predicted Effect probably benign
Transcript: ENSMUST00000230294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231001
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230339
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial outer membrane protein. It has a potential role in tumorigenesis, which may result from negative regulation of the p53 tumor suppressor gene. Alternatively spliced transcript variants have been noted for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI

All alleles(7) : Targeted(2) Gene trapped(5)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik A C 10: 115,406,104 (GRCm39) probably benign Het
Arhgap29 T A 3: 121,782,200 (GRCm39) S71T possibly damaging Het
BC048507 T C 13: 68,011,817 (GRCm39) Y65H probably damaging Het
C3 T C 17: 57,518,720 (GRCm39) E1221G probably benign Het
Calb1 G T 4: 15,885,656 (GRCm39) V76L probably benign Het
Crybg1 T A 10: 43,879,689 (GRCm39) K500* probably null Het
Csmd1 G A 8: 16,034,860 (GRCm39) T2437I probably benign Het
Cyp27b1 G A 10: 126,887,966 (GRCm39) V493I possibly damaging Het
Cyp3a44 T A 5: 145,740,554 (GRCm39) T29S probably benign Het
Dclk3 T C 9: 111,298,328 (GRCm39) V624A probably benign Het
Dnah6 T C 6: 73,069,140 (GRCm39) I2464V probably benign Het
Dock6 A T 9: 21,721,254 (GRCm39) probably null Het
Erap1 C T 13: 74,794,533 (GRCm39) T64I probably damaging Het
Erbb3 A T 10: 128,405,948 (GRCm39) Y1156* probably null Het
Fam168a G A 7: 100,484,602 (GRCm39) A231T probably benign Het
Farp1 C T 14: 121,472,489 (GRCm39) P208L probably damaging Het
Fbxo30 T C 10: 11,166,813 (GRCm39) Y512H probably damaging Het
Gcnt2 A T 13: 41,071,650 (GRCm39) I98F possibly damaging Het
Got1 G A 19: 43,493,036 (GRCm39) T295I probably benign Het
Herc2 A G 7: 55,844,010 (GRCm39) E3538G probably damaging Het
Kcnmb4 A T 10: 116,309,410 (GRCm39) V6E probably benign Het
Kmt2d G A 15: 98,749,990 (GRCm39) probably benign Het
Lynx1 G T 15: 74,623,462 (GRCm39) Y28* probably null Het
Mast1 T C 8: 85,652,136 (GRCm39) E304G probably damaging Het
Nipa1 G A 7: 55,629,205 (GRCm39) Q303* probably null Het
Nomo1 G A 7: 45,712,426 (GRCm39) R657H possibly damaging Het
Or51b4 C T 7: 103,530,541 (GRCm39) R303H probably benign Het
Pcdha7 T A 18: 37,108,628 (GRCm39) L551Q probably damaging Het
Pik3r4 T C 9: 105,525,930 (GRCm39) Y267H probably damaging Het
Pnliprp1 A G 19: 58,723,168 (GRCm39) D223G probably damaging Het
Prph G A 15: 98,953,281 (GRCm39) G65D probably benign Het
Pskh1 T C 8: 106,639,464 (GRCm39) L48P probably benign Het
Ptdss1 C A 13: 67,093,365 (GRCm39) N68K probably damaging Het
Rexo5 G A 7: 119,433,526 (GRCm39) G495R probably damaging Het
Ryr1 C A 7: 28,723,448 (GRCm39) A4204S possibly damaging Het
Serpinb9 G A 13: 33,199,659 (GRCm39) S318N probably damaging Het
Slc22a8 G A 19: 8,586,638 (GRCm39) R383H probably benign Het
Trim26 A G 17: 37,162,016 (GRCm39) H145R probably damaging Het
Trps1 A T 15: 50,695,286 (GRCm39) Y286* probably null Het
Vmn1r181 A G 7: 23,683,787 (GRCm39) N84S probably benign Het
Wdfy4 G T 14: 32,873,689 (GRCm39) Q207K probably benign Het
Whrn G A 4: 63,351,053 (GRCm39) T427I probably benign Het
Other mutations in Letmd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Letmd1 APN 15 100,369,640 (GRCm39) missense probably damaging 1.00
IGL02210:Letmd1 APN 15 100,367,128 (GRCm39) critical splice donor site probably null
IGL02486:Letmd1 APN 15 100,372,992 (GRCm39) missense probably damaging 1.00
IGL02606:Letmd1 APN 15 100,372,972 (GRCm39) missense probably damaging 1.00
IGL03218:Letmd1 APN 15 100,367,709 (GRCm39) missense probably damaging 1.00
lass UTSW 15 100,370,423 (GRCm39) splice site probably null
P0031:Letmd1 UTSW 15 100,370,490 (GRCm39) missense probably damaging 1.00
PIT4515001:Letmd1 UTSW 15 100,374,683 (GRCm39) missense probably damaging 1.00
R0737:Letmd1 UTSW 15 100,367,702 (GRCm39) missense probably damaging 1.00
R1466:Letmd1 UTSW 15 100,370,423 (GRCm39) splice site probably null
R1466:Letmd1 UTSW 15 100,370,423 (GRCm39) splice site probably null
R1584:Letmd1 UTSW 15 100,370,423 (GRCm39) splice site probably null
R4457:Letmd1 UTSW 15 100,373,011 (GRCm39) missense possibly damaging 0.54
R4641:Letmd1 UTSW 15 100,375,708 (GRCm39) missense probably damaging 1.00
R4724:Letmd1 UTSW 15 100,367,619 (GRCm39) missense probably damaging 1.00
R7407:Letmd1 UTSW 15 100,367,119 (GRCm39) missense probably benign 0.08
R8852:Letmd1 UTSW 15 100,373,247 (GRCm39) missense probably benign 0.01
Y5407:Letmd1 UTSW 15 100,373,290 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACTGGGTTCCTCAAGGAGAC -3'
(R):5'- AAGATGAGCTCAGGATGTGC -3'

Sequencing Primer
(F):5'- TCACGATAGCGACCTCAGG -3'
(R):5'- CGGTGGGAATCCTGCATG -3'
Posted On 2016-10-06