Incidental Mutation 'R5463:Got1'
ID 433132
Institutional Source Beutler Lab
Gene Symbol Got1
Ensembl Gene ENSMUSG00000025190
Gene Name glutamic-oxaloacetic transaminase 1, soluble
Synonyms cytosolic aspartate aminotransferase, Got-1, cAspAT
MMRRC Submission 043025-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5463 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 43488191-43513044 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 43493036 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 295 (T295I)
Ref Sequence ENSEMBL: ENSMUSP00000026196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026196]
AlphaFold P05201
Predicted Effect probably benign
Transcript: ENSMUST00000026196
AA Change: T295I

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000026196
Gene: ENSMUSG00000025190
AA Change: T295I

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 31 405 1.4e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132504
Predicted Effect probably benign
Transcript: ENSMUST00000133325
SMART Domains Protein: ENSMUSP00000117986
Gene: ENSMUSG00000025190

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 1 181 7.2e-39 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glutamic-oxaloacetic transaminase is a pyridoxal phosphate-dependent enzyme which exists in cytoplasmic and mitochondrial forms, GOT1 and GOT2, respectively. GOT plays a role in amino acid metabolism and the urea and tricarboxylic acid cycles. The two enzymes are homodimeric and show close homology. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik A C 10: 115,406,104 (GRCm39) probably benign Het
Arhgap29 T A 3: 121,782,200 (GRCm39) S71T possibly damaging Het
BC048507 T C 13: 68,011,817 (GRCm39) Y65H probably damaging Het
C3 T C 17: 57,518,720 (GRCm39) E1221G probably benign Het
Calb1 G T 4: 15,885,656 (GRCm39) V76L probably benign Het
Crybg1 T A 10: 43,879,689 (GRCm39) K500* probably null Het
Csmd1 G A 8: 16,034,860 (GRCm39) T2437I probably benign Het
Cyp27b1 G A 10: 126,887,966 (GRCm39) V493I possibly damaging Het
Cyp3a44 T A 5: 145,740,554 (GRCm39) T29S probably benign Het
Dclk3 T C 9: 111,298,328 (GRCm39) V624A probably benign Het
Dnah6 T C 6: 73,069,140 (GRCm39) I2464V probably benign Het
Dock6 A T 9: 21,721,254 (GRCm39) probably null Het
Erap1 C T 13: 74,794,533 (GRCm39) T64I probably damaging Het
Erbb3 A T 10: 128,405,948 (GRCm39) Y1156* probably null Het
Fam168a G A 7: 100,484,602 (GRCm39) A231T probably benign Het
Farp1 C T 14: 121,472,489 (GRCm39) P208L probably damaging Het
Fbxo30 T C 10: 11,166,813 (GRCm39) Y512H probably damaging Het
Gcnt2 A T 13: 41,071,650 (GRCm39) I98F possibly damaging Het
Herc2 A G 7: 55,844,010 (GRCm39) E3538G probably damaging Het
Kcnmb4 A T 10: 116,309,410 (GRCm39) V6E probably benign Het
Kmt2d G A 15: 98,749,990 (GRCm39) probably benign Het
Letmd1 C T 15: 100,367,009 (GRCm39) A2V probably damaging Het
Lynx1 G T 15: 74,623,462 (GRCm39) Y28* probably null Het
Mast1 T C 8: 85,652,136 (GRCm39) E304G probably damaging Het
Nipa1 G A 7: 55,629,205 (GRCm39) Q303* probably null Het
Nomo1 G A 7: 45,712,426 (GRCm39) R657H possibly damaging Het
Or51b4 C T 7: 103,530,541 (GRCm39) R303H probably benign Het
Pcdha7 T A 18: 37,108,628 (GRCm39) L551Q probably damaging Het
Pik3r4 T C 9: 105,525,930 (GRCm39) Y267H probably damaging Het
Pnliprp1 A G 19: 58,723,168 (GRCm39) D223G probably damaging Het
Prph G A 15: 98,953,281 (GRCm39) G65D probably benign Het
Pskh1 T C 8: 106,639,464 (GRCm39) L48P probably benign Het
Ptdss1 C A 13: 67,093,365 (GRCm39) N68K probably damaging Het
Rexo5 G A 7: 119,433,526 (GRCm39) G495R probably damaging Het
Ryr1 C A 7: 28,723,448 (GRCm39) A4204S possibly damaging Het
Serpinb9 G A 13: 33,199,659 (GRCm39) S318N probably damaging Het
Slc22a8 G A 19: 8,586,638 (GRCm39) R383H probably benign Het
Trim26 A G 17: 37,162,016 (GRCm39) H145R probably damaging Het
Trps1 A T 15: 50,695,286 (GRCm39) Y286* probably null Het
Vmn1r181 A G 7: 23,683,787 (GRCm39) N84S probably benign Het
Wdfy4 G T 14: 32,873,689 (GRCm39) Q207K probably benign Het
Whrn G A 4: 63,351,053 (GRCm39) T427I probably benign Het
Other mutations in Got1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Got1 APN 19 43,493,048 (GRCm39) missense possibly damaging 0.72
IGL01404:Got1 APN 19 43,493,048 (GRCm39) missense possibly damaging 0.72
IGL01431:Got1 APN 19 43,491,488 (GRCm39) nonsense probably null
IGL01476:Got1 APN 19 43,512,848 (GRCm39) missense probably damaging 1.00
IGL01688:Got1 APN 19 43,512,775 (GRCm39) critical splice donor site probably null
IGL01977:Got1 APN 19 43,504,284 (GRCm39) missense probably benign 0.00
IGL02353:Got1 APN 19 43,512,882 (GRCm39) missense probably damaging 1.00
IGL02360:Got1 APN 19 43,512,882 (GRCm39) missense probably damaging 1.00
IGL02726:Got1 APN 19 43,488,851 (GRCm39) splice site probably null
F5770:Got1 UTSW 19 43,489,000 (GRCm39) unclassified probably benign
R0128:Got1 UTSW 19 43,512,816 (GRCm39) missense probably benign
R0245:Got1 UTSW 19 43,492,946 (GRCm39) splice site probably benign
R0578:Got1 UTSW 19 43,504,222 (GRCm39) missense probably benign 0.01
R1116:Got1 UTSW 19 43,491,413 (GRCm39) nonsense probably null
R1927:Got1 UTSW 19 43,504,119 (GRCm39) critical splice donor site probably null
R4516:Got1 UTSW 19 43,493,280 (GRCm39) missense probably damaging 1.00
R4774:Got1 UTSW 19 43,491,345 (GRCm39) critical splice donor site probably null
R4785:Got1 UTSW 19 43,491,376 (GRCm39) missense possibly damaging 0.80
R6612:Got1 UTSW 19 43,493,242 (GRCm39) missense probably damaging 1.00
R7556:Got1 UTSW 19 43,491,469 (GRCm39) missense probably damaging 1.00
R7659:Got1 UTSW 19 43,493,078 (GRCm39) missense probably benign 0.00
R9778:Got1 UTSW 19 43,504,284 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AAAATTGCATCCTACGTCTCTGG -3'
(R):5'- GTCCTTCTCCAAGAACTTCGGG -3'

Sequencing Primer
(F):5'- GCATCCTACGTCTCTGGAAATAAAAG -3'
(R):5'- CAAGAACTTCGGGCTCTACAGTG -3'
Posted On 2016-10-06