Incidental Mutation 'R5464:Ptpru'
ID 433151
Institutional Source Beutler Lab
Gene Symbol Ptpru
Ensembl Gene ENSMUSG00000028909
Gene Name protein tyrosine phosphatase receptor type U
Synonyms RPTPlambda, Ptprl
MMRRC Submission 042850-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5464 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 131495768-131565599 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 131499868 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 1259 (G1259R)
Ref Sequence ENSEMBL: ENSMUSP00000101607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030741] [ENSMUST00000105987]
AlphaFold B1AUH1
Predicted Effect probably damaging
Transcript: ENSMUST00000030741
AA Change: G1269R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030741
Gene: ENSMUSG00000028909
AA Change: G1269R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
MAM 22 188 5.58e-68 SMART
IG 195 283 4.93e-3 SMART
FN3 285 368 3.79e-2 SMART
FN3 384 472 2.5e-2 SMART
FN3 488 576 3.62e-8 SMART
low complexity region 627 641 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
transmembrane domain 747 769 N/A INTRINSIC
PTPc 893 1146 5.95e-102 SMART
PTPc 1175 1441 3.67e-93 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105987
AA Change: G1259R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101607
Gene: ENSMUSG00000028909
AA Change: G1259R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
MAM 22 188 5.58e-68 SMART
IG 195 283 4.93e-3 SMART
FN3 285 368 3.79e-2 SMART
FN3 384 472 2.5e-2 SMART
FN3 488 576 3.62e-8 SMART
low complexity region 627 641 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
transmembrane domain 748 770 N/A INTRINSIC
PTPc 883 1136 5.95e-102 SMART
PTPc 1165 1431 3.67e-93 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144136
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. This PTP was thought to play roles in cell-cell recognition and adhesion. Studies of the similar gene in mice suggested the role of this PTP in early neural development. The expression of this gene was reported to be regulated by phorbol myristate acetate (PMA) or calcium ionophore in Jurkat T lymphoma cells. Alternatively spliced transcript variants have been reported. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G A 16: 4,682,227 (GRCm39) G180E probably damaging Het
Acsl1 T A 8: 46,958,775 (GRCm39) D95E probably benign Het
Acyp2 C T 11: 30,456,354 (GRCm39) E98K possibly damaging Het
Adamts16 T A 13: 70,909,868 (GRCm39) H895L probably benign Het
Alox12e T C 11: 70,208,505 (GRCm39) Y483C probably damaging Het
Atp13a2 T A 4: 140,733,381 (GRCm39) F952I probably damaging Het
Crot T G 5: 9,033,690 (GRCm39) probably null Het
Dnaja1 T A 4: 40,724,133 (GRCm39) M98K probably benign Het
Eps8 C T 6: 137,504,473 (GRCm39) G87R probably damaging Het
Flg2 C A 3: 93,109,277 (GRCm39) T435K possibly damaging Het
Gpatch4 T C 3: 87,962,062 (GRCm39) probably null Het
Heatr1 T A 13: 12,448,524 (GRCm39) M1795K probably benign Het
Ift52 T C 2: 162,871,735 (GRCm39) V189A probably benign Het
Kif21a T A 15: 90,878,058 (GRCm39) D250V probably damaging Het
Lrrc66 T C 5: 73,765,622 (GRCm39) T474A probably benign Het
Mcub T C 3: 129,709,365 (GRCm39) E316G probably benign Het
Mettl15 C T 2: 109,021,967 (GRCm39) V113I probably benign Het
Mroh8 T A 2: 157,063,150 (GRCm39) I824F probably damaging Het
Mrpl19 A G 6: 81,938,992 (GRCm39) M270T probably damaging Het
Naa12 C T 18: 80,255,138 (GRCm39) A144V probably damaging Het
Or10d4 A T 9: 39,581,066 (GRCm39) T238S probably damaging Het
Or4ac1-ps1 T C 2: 88,370,599 (GRCm39) Y58C probably null Het
Or51a25 A G 7: 102,373,124 (GRCm39) V191A possibly damaging Het
Or51a39 T C 7: 102,362,889 (GRCm39) T244A probably benign Het
Or51a43 C A 7: 103,717,674 (GRCm39) R188L possibly damaging Het
Or51f5 A G 7: 102,424,640 (GRCm39) K303R probably benign Het
Or52a24 T A 7: 103,381,396 (GRCm39) W88R probably damaging Het
Or5ak23 AAGTCTGGAGTC AAGTC 2: 85,245,057 (GRCm39) probably null Het
Or6x1 T C 9: 40,099,080 (GRCm39) I223T probably damaging Het
Pacs1 T C 19: 5,197,235 (GRCm39) M430V probably benign Het
Piezo2 A G 18: 63,278,176 (GRCm39) S243P probably damaging Het
Ppp1r36 A T 12: 76,474,852 (GRCm39) probably null Het
Prdm16 T A 4: 154,430,601 (GRCm39) probably null Het
Prss36 A T 7: 127,533,405 (GRCm39) W97R probably damaging Het
Psmg4 A T 13: 34,362,047 (GRCm39) I112F probably damaging Het
Rsph4a T C 10: 33,785,337 (GRCm39) I416T possibly damaging Het
Scn2a C T 2: 65,532,100 (GRCm39) R571C probably damaging Het
Selenbp1 A G 3: 94,851,727 (GRCm39) M423V probably benign Het
Serpina3i G A 12: 104,234,751 (GRCm39) A361T possibly damaging Het
Serpinb3c A T 1: 107,199,434 (GRCm39) D362E probably damaging Het
Sf3a3 T C 4: 124,622,033 (GRCm39) probably null Het
Sgcg A G 14: 61,474,304 (GRCm39) V113A possibly damaging Het
Slc3a2 T C 19: 8,691,008 (GRCm39) K74R probably damaging Het
Smco1 T A 16: 32,092,694 (GRCm39) W122R probably damaging Het
Snx19 A G 9: 30,339,269 (GRCm39) K136E possibly damaging Het
Trim32 A G 4: 65,532,625 (GRCm39) N394S probably damaging Het
Uqcrb T C 13: 67,048,889 (GRCm39) D87G probably damaging Het
Wipf3 T C 6: 54,462,308 (GRCm39) S173P possibly damaging Het
Zfp473 T C 7: 44,382,062 (GRCm39) E756G probably damaging Het
Other mutations in Ptpru
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Ptpru APN 4 131,535,546 (GRCm39) missense probably benign 0.00
IGL00966:Ptpru APN 4 131,499,927 (GRCm39) missense probably damaging 1.00
IGL01451:Ptpru APN 4 131,496,803 (GRCm39) utr 3 prime probably benign
IGL01453:Ptpru APN 4 131,496,803 (GRCm39) utr 3 prime probably benign
IGL01606:Ptpru APN 4 131,535,792 (GRCm39) missense possibly damaging 0.69
IGL02451:Ptpru APN 4 131,504,086 (GRCm39) splice site probably benign
IGL03135:Ptpru APN 4 131,546,111 (GRCm39) missense probably damaging 0.97
IGL03366:Ptpru APN 4 131,507,178 (GRCm39) missense probably damaging 1.00
PIT4366001:Ptpru UTSW 4 131,527,023 (GRCm39) missense probably benign 0.03
PIT4576001:Ptpru UTSW 4 131,529,855 (GRCm39) nonsense probably null
R0299:Ptpru UTSW 4 131,530,698 (GRCm39) nonsense probably null
R0458:Ptpru UTSW 4 131,526,986 (GRCm39) missense possibly damaging 0.49
R0502:Ptpru UTSW 4 131,520,954 (GRCm39) missense probably benign 0.02
R0503:Ptpru UTSW 4 131,520,954 (GRCm39) missense probably benign 0.02
R0619:Ptpru UTSW 4 131,548,198 (GRCm39) missense possibly damaging 0.91
R0639:Ptpru UTSW 4 131,498,490 (GRCm39) missense possibly damaging 0.49
R0843:Ptpru UTSW 4 131,525,259 (GRCm39) missense probably benign 0.10
R1065:Ptpru UTSW 4 131,535,651 (GRCm39) missense possibly damaging 0.49
R1170:Ptpru UTSW 4 131,535,838 (GRCm39) splice site probably benign
R1382:Ptpru UTSW 4 131,535,540 (GRCm39) missense probably damaging 0.98
R1442:Ptpru UTSW 4 131,535,580 (GRCm39) missense probably benign 0.00
R1538:Ptpru UTSW 4 131,501,662 (GRCm39) missense probably damaging 0.99
R1624:Ptpru UTSW 4 131,499,861 (GRCm39) missense probably damaging 1.00
R1688:Ptpru UTSW 4 131,514,656 (GRCm39) missense probably benign 0.01
R1699:Ptpru UTSW 4 131,506,361 (GRCm39) missense probably damaging 1.00
R1740:Ptpru UTSW 4 131,520,989 (GRCm39) splice site probably null
R1874:Ptpru UTSW 4 131,497,066 (GRCm39) missense probably benign
R1959:Ptpru UTSW 4 131,530,788 (GRCm39) missense probably damaging 1.00
R2051:Ptpru UTSW 4 131,546,398 (GRCm39) missense possibly damaging 0.80
R2200:Ptpru UTSW 4 131,548,124 (GRCm39) missense probably damaging 1.00
R2281:Ptpru UTSW 4 131,535,810 (GRCm39) missense probably damaging 1.00
R2304:Ptpru UTSW 4 131,499,879 (GRCm39) missense probably damaging 1.00
R2411:Ptpru UTSW 4 131,498,780 (GRCm39) missense probably damaging 1.00
R2845:Ptpru UTSW 4 131,546,972 (GRCm39) missense probably benign 0.00
R3767:Ptpru UTSW 4 131,535,735 (GRCm39) missense probably damaging 1.00
R3768:Ptpru UTSW 4 131,535,735 (GRCm39) missense probably damaging 1.00
R3769:Ptpru UTSW 4 131,535,735 (GRCm39) missense probably damaging 1.00
R3770:Ptpru UTSW 4 131,535,735 (GRCm39) missense probably damaging 1.00
R3937:Ptpru UTSW 4 131,501,615 (GRCm39) missense probably damaging 0.99
R4079:Ptpru UTSW 4 131,526,021 (GRCm39) critical splice donor site probably null
R4110:Ptpru UTSW 4 131,546,348 (GRCm39) missense probably damaging 1.00
R4170:Ptpru UTSW 4 131,503,659 (GRCm39) missense probably damaging 1.00
R4716:Ptpru UTSW 4 131,548,279 (GRCm39) missense probably benign
R4751:Ptpru UTSW 4 131,529,897 (GRCm39) missense probably damaging 0.97
R4766:Ptpru UTSW 4 131,548,275 (GRCm39) missense probably damaging 1.00
R4825:Ptpru UTSW 4 131,526,914 (GRCm39) missense probably benign
R4900:Ptpru UTSW 4 131,515,693 (GRCm39) missense probably damaging 0.99
R4998:Ptpru UTSW 4 131,504,196 (GRCm39) missense probably damaging 1.00
R5279:Ptpru UTSW 4 131,547,334 (GRCm39) missense possibly damaging 0.62
R5625:Ptpru UTSW 4 131,530,691 (GRCm39) missense probably null 1.00
R5667:Ptpru UTSW 4 131,547,501 (GRCm39) missense possibly damaging 0.94
R5671:Ptpru UTSW 4 131,547,501 (GRCm39) missense possibly damaging 0.94
R5735:Ptpru UTSW 4 131,565,401 (GRCm39) missense probably benign 0.01
R5802:Ptpru UTSW 4 131,515,688 (GRCm39) missense possibly damaging 0.84
R5809:Ptpru UTSW 4 131,513,067 (GRCm39) missense probably benign 0.34
R5953:Ptpru UTSW 4 131,504,148 (GRCm39) missense probably damaging 1.00
R5973:Ptpru UTSW 4 131,546,236 (GRCm39) missense probably benign 0.00
R6029:Ptpru UTSW 4 131,498,604 (GRCm39) missense probably damaging 1.00
R6072:Ptpru UTSW 4 131,503,539 (GRCm39) missense probably damaging 0.99
R6089:Ptpru UTSW 4 131,499,941 (GRCm39) missense possibly damaging 0.94
R6174:Ptpru UTSW 4 131,513,065 (GRCm39) missense probably benign
R6177:Ptpru UTSW 4 131,520,836 (GRCm39) missense probably benign 0.00
R6367:Ptpru UTSW 4 131,501,663 (GRCm39) missense probably benign 0.18
R6682:Ptpru UTSW 4 131,548,093 (GRCm39) missense probably benign
R6950:Ptpru UTSW 4 131,503,663 (GRCm39) missense probably damaging 0.99
R7159:Ptpru UTSW 4 131,546,851 (GRCm39) missense probably damaging 1.00
R7736:Ptpru UTSW 4 131,515,693 (GRCm39) missense probably damaging 1.00
R7960:Ptpru UTSW 4 131,515,820 (GRCm39) missense probably benign 0.01
R8094:Ptpru UTSW 4 131,520,903 (GRCm39) missense possibly damaging 0.88
R8262:Ptpru UTSW 4 131,522,274 (GRCm39) nonsense probably null
R8276:Ptpru UTSW 4 131,506,484 (GRCm39) missense probably damaging 1.00
R8355:Ptpru UTSW 4 131,535,811 (GRCm39) missense probably damaging 1.00
R8377:Ptpru UTSW 4 131,535,646 (GRCm39) missense probably damaging 1.00
R8416:Ptpru UTSW 4 131,535,783 (GRCm39) missense probably damaging 1.00
R8858:Ptpru UTSW 4 131,526,825 (GRCm39) splice site probably benign
R8911:Ptpru UTSW 4 131,503,560 (GRCm39) missense probably damaging 0.96
R8934:Ptpru UTSW 4 131,546,297 (GRCm39) missense probably damaging 0.98
R9031:Ptpru UTSW 4 131,515,691 (GRCm39) missense probably damaging 1.00
R9069:Ptpru UTSW 4 131,503,565 (GRCm39) missense possibly damaging 0.87
R9096:Ptpru UTSW 4 131,499,843 (GRCm39) missense probably damaging 1.00
R9097:Ptpru UTSW 4 131,499,843 (GRCm39) missense probably damaging 1.00
R9151:Ptpru UTSW 4 131,522,278 (GRCm39) missense probably benign
R9166:Ptpru UTSW 4 131,525,180 (GRCm39) missense probably benign 0.00
R9174:Ptpru UTSW 4 131,535,746 (GRCm39) missense probably damaging 1.00
R9242:Ptpru UTSW 4 131,530,341 (GRCm39) missense probably damaging 1.00
R9698:Ptpru UTSW 4 131,547,531 (GRCm39) missense probably benign 0.09
X0024:Ptpru UTSW 4 131,498,501 (GRCm39) missense probably benign 0.15
Z1177:Ptpru UTSW 4 131,535,573 (GRCm39) missense probably damaging 0.99
Z1177:Ptpru UTSW 4 131,527,017 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGATCAAGCCTGCACAACAG -3'
(R):5'- GAAAGTCTCTGGTCACCCATGTG -3'

Sequencing Primer
(F):5'- TCCCAGGTGCTCAGTTAAAAAG -3'
(R):5'- ACCCATGTGAGAGTACTGGCTTC -3'
Posted On 2016-10-06