Mutagenetix > Incidental Mutation

Incidental Mutation 'R5464:Ptpru'

433151

Institutional Source

Beutler Lab

Gene Symbol

Ptpru

Ensembl Gene

ENSMUSG00000028909

Gene Name

protein tyrosine phosphatase, receptor type, U

Synonyms

Ptprl, RPTPlambda

MMRRC Submission

042850-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5464 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

131768457-131838288 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 131772557 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 1259 (G1259R)

Ref Sequence

ENSEMBL: ENSMUSP00000101607 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030741] [ENSMUST00000105987]

AlphaFold

B1AUH1

Predicted Effect

probably damaging
Transcript: ENSMUST00000030741
AA Change: G1269R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000030741
Gene: ENSMUSG00000028909
AA Change: G1269R

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
MAM	22	188	5.58e-68	SMART
IG	195	283	4.93e-3	SMART
FN3	285	368	3.79e-2	SMART
FN3	384	472	2.5e-2	SMART
FN3	488	576	3.62e-8	SMART
low complexity region	627	641	N/A	INTRINSIC
low complexity region	667	677	N/A	INTRINSIC
transmembrane domain	747	769	N/A	INTRINSIC
PTPc	893	1146	5.95e-102	SMART
PTPc	1175	1441	3.67e-93	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000105987
AA Change: G1259R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101607
Gene: ENSMUSG00000028909
AA Change: G1259R

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
MAM	22	188	5.58e-68	SMART
IG	195	283	4.93e-3	SMART
FN3	285	368	3.79e-2	SMART
FN3	384	472	2.5e-2	SMART
FN3	488	576	3.62e-8	SMART
low complexity region	627	641	N/A	INTRINSIC
low complexity region	667	677	N/A	INTRINSIC
transmembrane domain	748	770	N/A	INTRINSIC
PTPc	883	1136	5.95e-102	SMART
PTPc	1165	1431	3.67e-93	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127633

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144136

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. This PTP was thought to play roles in cell-cell recognition and adhesion. Studies of the similar gene in mice suggested the role of this PTP in early neural development. The expression of this gene was reported to be regulated by phorbol myristate acetate (PMA) or calcium ionophore in Jurkat T lymphoma cells. Alternatively spliced transcript variants have been reported. [provided by RefSeq, Aug 2010]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	G	A	16: 4,864,363	G180E	probably damaging	Het
Acsl1	T	A	8: 46,505,738	D95E	probably benign	Het
Acyp2	C	T	11: 30,506,354	E98K	possibly damaging	Het
Adamts16	T	A	13: 70,761,749	H895L	probably benign	Het
Alox12e	T	C	11: 70,317,679	Y483C	probably damaging	Het
Atp13a2	T	A	4: 141,006,070	F952I	probably damaging	Het
Crot	T	G	5: 8,983,690		probably null	Het
Dnaja1	T	A	4: 40,724,133	M98K	probably benign	Het
Eps8	C	T	6: 137,527,475	G87R	probably damaging	Het
Flg2	C	A	3: 93,201,970	T435K	possibly damaging	Het
Gm16286	C	T	18: 80,211,923	A144V	probably damaging	Het
Gpatch4	T	C	3: 88,054,755		probably null	Het
Heatr1	T	A	13: 12,433,643	M1795K	probably benign	Het
Ift52	T	C	2: 163,029,815	V189A	probably benign	Het
Kif21a	T	A	15: 90,993,855	D250V	probably damaging	Het
Lrrc66	T	C	5: 73,608,279	T474A	probably benign	Het
Mcub	T	C	3: 129,915,716	E316G	probably benign	Het
Mettl15	C	T	2: 109,191,622	V113I	probably benign	Het
Mroh8	T	A	2: 157,221,230	I824F	probably damaging	Het
Mrpl19	A	G	6: 81,962,011	M270T	probably damaging	Het
Olfr1187-ps1	T	C	2: 88,540,255	Y58C	probably null	Het
Olfr33	T	C	7: 102,713,682	T244A	probably benign	Het
Olfr559	A	G	7: 102,723,917	V191A	possibly damaging	Het
Olfr561	A	G	7: 102,775,433	K303R	probably benign	Het
Olfr628	T	A	7: 103,732,189	W88R	probably damaging	Het
Olfr644	C	A	7: 104,068,467	R188L	possibly damaging	Het
Olfr963	A	T	9: 39,669,770	T238S	probably damaging	Het
Olfr986	T	C	9: 40,187,784	I223T	probably damaging	Het
Olfr993	AAGTCTGGAGTC	AAGTC	2: 85,414,713		probably null	Het
Pacs1	T	C	19: 5,147,207	M430V	probably benign	Het
Piezo2	A	G	18: 63,145,105	S243P	probably damaging	Het
Ppp1r36	A	T	12: 76,428,078		probably null	Het
Prdm16	T	A	4: 154,346,144		probably null	Het
Prss36	A	T	7: 127,934,233	W97R	probably damaging	Het
Psmg4	A	T	13: 34,178,064	I112F	probably damaging	Het
Rsph4a	T	C	10: 33,909,341	I416T	possibly damaging	Het
Scn2a	C	T	2: 65,701,756	R571C	probably damaging	Het
Selenbp1	A	G	3: 94,944,416	M423V	probably benign	Het
Serpina3i	G	A	12: 104,268,492	A361T	possibly damaging	Het
Serpinb3c	A	T	1: 107,271,704	D362E	probably damaging	Het
Sf3a3	T	C	4: 124,728,240		probably null	Het
Sgcg	A	G	14: 61,236,855	V113A	possibly damaging	Het
Slc3a2	T	C	19: 8,713,644	K74R	probably damaging	Het
Smco1	T	A	16: 32,273,876	W122R	probably damaging	Het
Snx19	A	G	9: 30,427,973	K136E	possibly damaging	Het
Trim32	A	G	4: 65,614,388	N394S	probably damaging	Het
Uqcrb	T	C	13: 66,900,825	D87G	probably damaging	Het
Wipf3	T	C	6: 54,485,323	S173P	possibly damaging	Het
Zfp473	T	C	7: 44,732,638	E756G	probably damaging	Het

Other mutations in Ptpru

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00481:Ptpru	APN	4	131808235	missense	probably benign	0.00
IGL00966:Ptpru	APN	4	131772616	missense	probably damaging	1.00
IGL01451:Ptpru	APN	4	131769492	utr 3 prime	probably benign
IGL01453:Ptpru	APN	4	131769492	utr 3 prime	probably benign
IGL01606:Ptpru	APN	4	131808481	missense	possibly damaging	0.69
IGL02451:Ptpru	APN	4	131776775	splice site	probably benign
IGL03135:Ptpru	APN	4	131818800	missense	probably damaging	0.97
IGL03366:Ptpru	APN	4	131779867	missense	probably damaging	1.00
PIT4366001:Ptpru	UTSW	4	131799712	missense	probably benign	0.03
PIT4576001:Ptpru	UTSW	4	131802544	nonsense	probably null
R0299:Ptpru	UTSW	4	131803387	nonsense	probably null
R0458:Ptpru	UTSW	4	131799675	missense	possibly damaging	0.49
R0502:Ptpru	UTSW	4	131793643	missense	probably benign	0.02
R0503:Ptpru	UTSW	4	131793643	missense	probably benign	0.02
R0619:Ptpru	UTSW	4	131820887	missense	possibly damaging	0.91
R0639:Ptpru	UTSW	4	131771179	missense	possibly damaging	0.49
R0843:Ptpru	UTSW	4	131797948	missense	probably benign	0.10
R1065:Ptpru	UTSW	4	131808340	missense	possibly damaging	0.49
R1170:Ptpru	UTSW	4	131808527	splice site	probably benign
R1382:Ptpru	UTSW	4	131808229	missense	probably damaging	0.98
R1442:Ptpru	UTSW	4	131808269	missense	probably benign	0.00
R1538:Ptpru	UTSW	4	131774351	missense	probably damaging	0.99
R1624:Ptpru	UTSW	4	131772550	missense	probably damaging	1.00
R1688:Ptpru	UTSW	4	131787345	missense	probably benign	0.01
R1699:Ptpru	UTSW	4	131779050	missense	probably damaging	1.00
R1740:Ptpru	UTSW	4	131793678	splice site	probably null
R1874:Ptpru	UTSW	4	131769755	missense	probably benign
R1959:Ptpru	UTSW	4	131803477	missense	probably damaging	1.00
R2051:Ptpru	UTSW	4	131819087	missense	possibly damaging	0.80
R2200:Ptpru	UTSW	4	131820813	missense	probably damaging	1.00
R2281:Ptpru	UTSW	4	131808499	missense	probably damaging	1.00
R2304:Ptpru	UTSW	4	131772568	missense	probably damaging	1.00
R2411:Ptpru	UTSW	4	131771469	missense	probably damaging	1.00
R2845:Ptpru	UTSW	4	131819661	missense	probably benign	0.00
R3767:Ptpru	UTSW	4	131808424	missense	probably damaging	1.00
R3768:Ptpru	UTSW	4	131808424	missense	probably damaging	1.00
R3769:Ptpru	UTSW	4	131808424	missense	probably damaging	1.00
R3770:Ptpru	UTSW	4	131808424	missense	probably damaging	1.00
R3937:Ptpru	UTSW	4	131774304	missense	probably damaging	0.99
R4079:Ptpru	UTSW	4	131798710	critical splice donor site	probably null
R4110:Ptpru	UTSW	4	131819037	missense	probably damaging	1.00
R4170:Ptpru	UTSW	4	131776348	missense	probably damaging	1.00
R4716:Ptpru	UTSW	4	131820968	missense	probably benign
R4751:Ptpru	UTSW	4	131802586	missense	probably damaging	0.97
R4766:Ptpru	UTSW	4	131820964	missense	probably damaging	1.00
R4825:Ptpru	UTSW	4	131799603	missense	probably benign
R4900:Ptpru	UTSW	4	131788382	missense	probably damaging	0.99
R4998:Ptpru	UTSW	4	131776885	missense	probably damaging	1.00
R5279:Ptpru	UTSW	4	131820023	missense	possibly damaging	0.62
R5625:Ptpru	UTSW	4	131803380	missense	probably null	1.00
R5667:Ptpru	UTSW	4	131820190	missense	possibly damaging	0.94
R5671:Ptpru	UTSW	4	131820190	missense	possibly damaging	0.94
R5735:Ptpru	UTSW	4	131838090	missense	probably benign	0.01
R5802:Ptpru	UTSW	4	131788377	missense	possibly damaging	0.84
R5809:Ptpru	UTSW	4	131785756	missense	probably benign	0.34
R5953:Ptpru	UTSW	4	131776837	missense	probably damaging	1.00
R5973:Ptpru	UTSW	4	131818925	missense	probably benign	0.00
R6029:Ptpru	UTSW	4	131771293	missense	probably damaging	1.00
R6072:Ptpru	UTSW	4	131776228	missense	probably damaging	0.99
R6089:Ptpru	UTSW	4	131772630	missense	possibly damaging	0.94
R6174:Ptpru	UTSW	4	131785754	missense	probably benign
R6177:Ptpru	UTSW	4	131793525	missense	probably benign	0.00
R6367:Ptpru	UTSW	4	131774352	missense	probably benign	0.18
R6682:Ptpru	UTSW	4	131820782	missense	probably benign
R6950:Ptpru	UTSW	4	131776352	missense	probably damaging	0.99
R7159:Ptpru	UTSW	4	131819540	missense	probably damaging	1.00
R7736:Ptpru	UTSW	4	131788382	missense	probably damaging	1.00
R7960:Ptpru	UTSW	4	131788509	missense	probably benign	0.01
R8094:Ptpru	UTSW	4	131793592	missense	possibly damaging	0.88
R8262:Ptpru	UTSW	4	131794963	nonsense	probably null
R8276:Ptpru	UTSW	4	131779173	missense	probably damaging	1.00
R8355:Ptpru	UTSW	4	131808500	missense	probably damaging	1.00
R8377:Ptpru	UTSW	4	131808335	missense	probably damaging	1.00
R8416:Ptpru	UTSW	4	131808472	missense	probably damaging	1.00
R8858:Ptpru	UTSW	4	131799514	splice site	probably benign
R8911:Ptpru	UTSW	4	131776249	missense	probably damaging	0.96
R8934:Ptpru	UTSW	4	131818986	missense	probably damaging	0.98
R9031:Ptpru	UTSW	4	131788380	missense	probably damaging	1.00
R9069:Ptpru	UTSW	4	131776254	missense	possibly damaging	0.87
R9096:Ptpru	UTSW	4	131772532	missense	probably damaging	1.00
R9097:Ptpru	UTSW	4	131772532	missense	probably damaging	1.00
R9151:Ptpru	UTSW	4	131794967	missense	probably benign
R9166:Ptpru	UTSW	4	131797869	missense	probably benign	0.00
R9174:Ptpru	UTSW	4	131808435	missense	probably damaging	1.00
R9242:Ptpru	UTSW	4	131803030	missense	probably damaging	1.00
R9698:Ptpru	UTSW	4	131820220	missense	probably benign	0.09
X0024:Ptpru	UTSW	4	131771190	missense	probably benign	0.15
Z1177:Ptpru	UTSW	4	131799706	missense	probably benign	0.00
Z1177:Ptpru	UTSW	4	131808262	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGATCAAGCCTGCACAACAG -3'
(R):5'- GAAAGTCTCTGGTCACCCATGTG -3'

Sequencing Primer
(F):5'- TCCCAGGTGCTCAGTTAAAAAG -3'
(R):5'- ACCCATGTGAGAGTACTGGCTTC -3'

Posted On

2016-10-06