Incidental Mutation 'R5464:Mrpl19'
ID433157
Institutional Source Beutler Lab
Gene Symbol Mrpl19
Ensembl Gene ENSMUSG00000030045
Gene Namemitochondrial ribosomal protein L19
SynonymsRpml15, D6Ertd157e, 9030416F12Rik, RLX1, MRP-L15
MMRRC Submission 042850-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.915) question?
Stock #R5464 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location81957851-81965958 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81962011 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 270 (M270T)
Ref Sequence ENSEMBL: ENSMUSP00000032124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032124] [ENSMUST00000043195] [ENSMUST00000152996]
AlphaFold Q9D338
Predicted Effect probably damaging
Transcript: ENSMUST00000032124
AA Change: M270T

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032124
Gene: ENSMUSG00000030045
AA Change: M270T

DomainStartEndE-ValueType
low complexity region 60 74 N/A INTRINSIC
Pfam:Ribosomal_L19 92 198 9e-19 PFAM
SCOP:d1fura_ 214 282 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043195
SMART Domains Protein: ENSMUSP00000035644
Gene: ENSMUSG00000035125

DomainStartEndE-ValueType
low complexity region 16 24 N/A INTRINSIC
low complexity region 43 66 N/A INTRINSIC
low complexity region 97 111 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 193 210 N/A INTRINSIC
coiled coil region 255 308 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
Pfam:GCFC 456 672 3e-34 PFAM
low complexity region 753 763 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148025
Predicted Effect probably benign
Transcript: ENSMUST00000152996
SMART Domains Protein: ENSMUSP00000138136
Gene: ENSMUSG00000035125

DomainStartEndE-ValueType
low complexity region 16 24 N/A INTRINSIC
low complexity region 43 66 N/A INTRINSIC
low complexity region 97 111 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 193 210 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203959
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G A 16: 4,864,363 G180E probably damaging Het
Acsl1 T A 8: 46,505,738 D95E probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adamts16 T A 13: 70,761,749 H895L probably benign Het
Alox12e T C 11: 70,317,679 Y483C probably damaging Het
Atp13a2 T A 4: 141,006,070 F952I probably damaging Het
Crot T G 5: 8,983,690 probably null Het
Dnaja1 T A 4: 40,724,133 M98K probably benign Het
Eps8 C T 6: 137,527,475 G87R probably damaging Het
Flg2 C A 3: 93,201,970 T435K possibly damaging Het
Gm16286 C T 18: 80,211,923 A144V probably damaging Het
Gpatch4 T C 3: 88,054,755 probably null Het
Heatr1 T A 13: 12,433,643 M1795K probably benign Het
Ift52 T C 2: 163,029,815 V189A probably benign Het
Kif21a T A 15: 90,993,855 D250V probably damaging Het
Lrrc66 T C 5: 73,608,279 T474A probably benign Het
Mcub T C 3: 129,915,716 E316G probably benign Het
Mettl15 C T 2: 109,191,622 V113I probably benign Het
Mroh8 T A 2: 157,221,230 I824F probably damaging Het
Olfr1187-ps1 T C 2: 88,540,255 Y58C probably null Het
Olfr33 T C 7: 102,713,682 T244A probably benign Het
Olfr559 A G 7: 102,723,917 V191A possibly damaging Het
Olfr561 A G 7: 102,775,433 K303R probably benign Het
Olfr628 T A 7: 103,732,189 W88R probably damaging Het
Olfr644 C A 7: 104,068,467 R188L possibly damaging Het
Olfr963 A T 9: 39,669,770 T238S probably damaging Het
Olfr986 T C 9: 40,187,784 I223T probably damaging Het
Olfr993 AAGTCTGGAGTC AAGTC 2: 85,414,713 probably null Het
Pacs1 T C 19: 5,147,207 M430V probably benign Het
Piezo2 A G 18: 63,145,105 S243P probably damaging Het
Ppp1r36 A T 12: 76,428,078 probably null Het
Prdm16 T A 4: 154,346,144 probably null Het
Prss36 A T 7: 127,934,233 W97R probably damaging Het
Psmg4 A T 13: 34,178,064 I112F probably damaging Het
Ptpru C T 4: 131,772,557 G1259R probably damaging Het
Rsph4a T C 10: 33,909,341 I416T possibly damaging Het
Scn2a C T 2: 65,701,756 R571C probably damaging Het
Selenbp1 A G 3: 94,944,416 M423V probably benign Het
Serpina3i G A 12: 104,268,492 A361T possibly damaging Het
Serpinb3c A T 1: 107,271,704 D362E probably damaging Het
Sf3a3 T C 4: 124,728,240 probably null Het
Sgcg A G 14: 61,236,855 V113A possibly damaging Het
Slc3a2 T C 19: 8,713,644 K74R probably damaging Het
Smco1 T A 16: 32,273,876 W122R probably damaging Het
Snx19 A G 9: 30,427,973 K136E possibly damaging Het
Trim32 A G 4: 65,614,388 N394S probably damaging Het
Uqcrb T C 13: 66,900,825 D87G probably damaging Het
Wipf3 T C 6: 54,485,323 S173P possibly damaging Het
Zfp473 T C 7: 44,732,638 E756G probably damaging Het
Other mutations in Mrpl19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Mrpl19 APN 6 81965872 missense probably benign 0.02
IGL00563:Mrpl19 APN 6 81965872 missense probably benign 0.02
IGL02113:Mrpl19 APN 6 81965915 missense probably benign
IGL02116:Mrpl19 APN 6 81965777 missense probably benign 0.41
IGL02256:Mrpl19 APN 6 81964319 missense probably benign 0.06
IGL02347:Mrpl19 APN 6 81962011 missense probably damaging 0.99
IGL02415:Mrpl19 APN 6 81963961 missense probably benign 0.29
IGL02825:Mrpl19 APN 6 81965815 missense probably benign 0.25
IGL03189:Mrpl19 APN 6 81961993 nonsense probably null
R1824:Mrpl19 UTSW 6 81964079 splice site probably null
R2310:Mrpl19 UTSW 6 81964073 splice site probably null
R3176:Mrpl19 UTSW 6 81964066 missense probably damaging 0.99
R3276:Mrpl19 UTSW 6 81964066 missense probably damaging 0.99
R3821:Mrpl19 UTSW 6 81962006 nonsense probably null
R4705:Mrpl19 UTSW 6 81964285 missense probably damaging 0.99
R4736:Mrpl19 UTSW 6 81964348 missense probably damaging 1.00
R7408:Mrpl19 UTSW 6 81965812 missense possibly damaging 0.65
R7835:Mrpl19 UTSW 6 81962126 missense probably damaging 1.00
R7956:Mrpl19 UTSW 6 81963981 missense probably benign 0.00
R8432:Mrpl19 UTSW 6 81962155 missense probably damaging 1.00
Z1177:Mrpl19 UTSW 6 81964310 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATTCTCAGAACAAGGGC -3'
(R):5'- TTTGTGTGCACCTCACCAG -3'

Sequencing Primer
(F):5'- CAAGACAGGGTTTCTCTGTATAGCC -3'
(R):5'- AGCCCACAATTCCTGTTTTTG -3'
Posted On2016-10-06