Incidental Mutation 'R5464:Ppp1r36'
ID433176
Institutional Source Beutler Lab
Gene Symbol Ppp1r36
Ensembl Gene ENSMUSG00000052221
Gene Nameprotein phosphatase 1, regulatory subunit 36
Synonyms
MMRRC Submission 042850-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #R5464 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location76417538-76439492 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 76428078 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063977] [ENSMUST00000063977] [ENSMUST00000220187]
Predicted Effect probably null
Transcript: ENSMUST00000063977
SMART Domains Protein: ENSMUSP00000069849
Gene: ENSMUSG00000052221

DomainStartEndE-ValueType
Pfam:PPPI_inhib 52 402 5.7e-109 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000063977
SMART Domains Protein: ENSMUSP00000069849
Gene: ENSMUSG00000052221

DomainStartEndE-ValueType
Pfam:PPPI_inhib 52 402 5.7e-109 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218732
Predicted Effect probably null
Transcript: ENSMUST00000220187
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G A 16: 4,864,363 G180E probably damaging Het
Acsl1 T A 8: 46,505,738 D95E probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adamts16 T A 13: 70,761,749 H895L probably benign Het
Alox12e T C 11: 70,317,679 Y483C probably damaging Het
Atp13a2 T A 4: 141,006,070 F952I probably damaging Het
Crot T G 5: 8,983,690 probably null Het
Dnaja1 T A 4: 40,724,133 M98K probably benign Het
Eps8 C T 6: 137,527,475 G87R probably damaging Het
Flg2 C A 3: 93,201,970 T435K possibly damaging Het
Gm16286 C T 18: 80,211,923 A144V probably damaging Het
Gpatch4 T C 3: 88,054,755 probably null Het
Heatr1 T A 13: 12,433,643 M1795K probably benign Het
Ift52 T C 2: 163,029,815 V189A probably benign Het
Kif21a T A 15: 90,993,855 D250V probably damaging Het
Lrrc66 T C 5: 73,608,279 T474A probably benign Het
Mcub T C 3: 129,915,716 E316G probably benign Het
Mettl15 C T 2: 109,191,622 V113I probably benign Het
Mroh8 T A 2: 157,221,230 I824F probably damaging Het
Mrpl19 A G 6: 81,962,011 M270T probably damaging Het
Olfr1187-ps1 T C 2: 88,540,255 Y58C probably null Het
Olfr33 T C 7: 102,713,682 T244A probably benign Het
Olfr559 A G 7: 102,723,917 V191A possibly damaging Het
Olfr561 A G 7: 102,775,433 K303R probably benign Het
Olfr628 T A 7: 103,732,189 W88R probably damaging Het
Olfr644 C A 7: 104,068,467 R188L possibly damaging Het
Olfr963 A T 9: 39,669,770 T238S probably damaging Het
Olfr986 T C 9: 40,187,784 I223T probably damaging Het
Olfr993 AAGTCTGGAGTC AAGTC 2: 85,414,713 probably null Het
Pacs1 T C 19: 5,147,207 M430V probably benign Het
Piezo2 A G 18: 63,145,105 S243P probably damaging Het
Prdm16 T A 4: 154,346,144 probably null Het
Prss36 A T 7: 127,934,233 W97R probably damaging Het
Psmg4 A T 13: 34,178,064 I112F probably damaging Het
Ptpru C T 4: 131,772,557 G1259R probably damaging Het
Rsph4a T C 10: 33,909,341 I416T possibly damaging Het
Scn2a C T 2: 65,701,756 R571C probably damaging Het
Selenbp1 A G 3: 94,944,416 M423V probably benign Het
Serpina3i G A 12: 104,268,492 A361T possibly damaging Het
Serpinb3c A T 1: 107,271,704 D362E probably damaging Het
Sf3a3 T C 4: 124,728,240 probably null Het
Sgcg A G 14: 61,236,855 V113A possibly damaging Het
Slc3a2 T C 19: 8,713,644 K74R probably damaging Het
Smco1 T A 16: 32,273,876 W122R probably damaging Het
Snx19 A G 9: 30,427,973 K136E possibly damaging Het
Trim32 A G 4: 65,614,388 N394S probably damaging Het
Uqcrb T C 13: 66,900,825 D87G probably damaging Het
Wipf3 T C 6: 54,485,323 S173P possibly damaging Het
Zfp473 T C 7: 44,732,638 E756G probably damaging Het
Other mutations in Ppp1r36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01585:Ppp1r36 APN 12 76439117 critical splice acceptor site probably null
IGL01744:Ppp1r36 APN 12 76439232 missense possibly damaging 0.83
IGL03295:Ppp1r36 APN 12 76438418 missense probably damaging 0.97
R0099:Ppp1r36 UTSW 12 76436282 splice site probably null
R0332:Ppp1r36 UTSW 12 76427903 missense probably benign 0.32
R0463:Ppp1r36 UTSW 12 76418967 missense probably damaging 0.98
R0491:Ppp1r36 UTSW 12 76439291 missense probably benign 0.01
R1664:Ppp1r36 UTSW 12 76436254 missense possibly damaging 0.84
R2011:Ppp1r36 UTSW 12 76418926 critical splice acceptor site probably null
R3918:Ppp1r36 UTSW 12 76417657 missense probably benign 0.00
R5352:Ppp1r36 UTSW 12 76428083 missense probably damaging 1.00
R5490:Ppp1r36 UTSW 12 76437986 missense probably damaging 0.98
R5490:Ppp1r36 UTSW 12 76437987 missense possibly damaging 0.85
R5523:Ppp1r36 UTSW 12 76438118 missense possibly damaging 0.71
R5844:Ppp1r36 UTSW 12 76426792 missense possibly damaging 0.71
R5849:Ppp1r36 UTSW 12 76439157 missense probably damaging 0.99
R5866:Ppp1r36 UTSW 12 76426805 missense possibly damaging 0.71
R5996:Ppp1r36 UTSW 12 76439162 missense possibly damaging 0.71
R6443:Ppp1r36 UTSW 12 76417639 missense probably benign
R6612:Ppp1r36 UTSW 12 76437604 missense possibly damaging 0.52
R6756:Ppp1r36 UTSW 12 76427922 missense probably benign 0.28
R7979:Ppp1r36 UTSW 12 76428149 splice site probably null
X0025:Ppp1r36 UTSW 12 76426810 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTGACAGATAAAAGGTTTGCCTC -3'
(R):5'- CTCAGGTAGCTCTCCCAGATTC -3'

Sequencing Primer
(F):5'- AAGGTTTGCCTCAAGGGATG -3'
(R):5'- CAGATTCTAGTCTAGACTTGCGCAG -3'
Posted On2016-10-06