Incidental Mutation 'R5464:Sgcg'
ID433181
Institutional Source Beutler Lab
Gene Symbol Sgcg
Ensembl Gene ENSMUSG00000035296
Gene Namesarcoglycan, gamma (dystrophin-associated glycoprotein)
Synonymsgamma-SG, 5430420E18Rik
MMRRC Submission 042850-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R5464 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location61219115-61258490 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61236855 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 113 (V113A)
Ref Sequence ENSEMBL: ENSMUSP00000112576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077954] [ENSMUST00000089394] [ENSMUST00000121148]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077954
AA Change: V113A

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000077106
Gene: ENSMUSG00000035296
AA Change: V113A

DomainStartEndE-ValueType
Pfam:Sarcoglycan_1 25 280 1.2e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089394
SMART Domains Protein: ENSMUSP00000086816
Gene: ENSMUSG00000048279

DomainStartEndE-ValueType
SCOP:d1lm8b_ 8 66 3e-3 SMART
Blast:UBQ 9 81 3e-31 BLAST
Blast:HATPase_c 116 211 2e-10 BLAST
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121148
AA Change: V113A

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112576
Gene: ENSMUSG00000035296
AA Change: V113A

DomainStartEndE-ValueType
Pfam:Sarcoglycan_1 23 284 1.1e-106 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129886
SMART Domains Protein: ENSMUSP00000117191
Gene: ENSMUSG00000035296

DomainStartEndE-ValueType
Pfam:Sarcoglycan_1 1 81 8e-20 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes gamma-sarcoglycan, one of several sarcolemmal transmembrane glycoproteins that interact with dystrophin. The dystrophin-glycoprotein complex (DGC) spans the sarcolemma and is comprised of dystrophin, syntrophin, alpha- and beta-dystroglycans and sarcoglycans. The DGC provides a structural link between the subsarcolemmal cytoskeleton and the extracellular matrix of muscle cells. Defects in the encoded protein can lead to early onset autosomal recessive muscular dystrophy, in particular limb-girdle muscular dystrophy, type 2C (LGMD2C). [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in muscles and heart similar to muscular dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G A 16: 4,864,363 G180E probably damaging Het
Acsl1 T A 8: 46,505,738 D95E probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adamts16 T A 13: 70,761,749 H895L probably benign Het
Alox12e T C 11: 70,317,679 Y483C probably damaging Het
Atp13a2 T A 4: 141,006,070 F952I probably damaging Het
Crot T G 5: 8,983,690 probably null Het
Dnaja1 T A 4: 40,724,133 M98K probably benign Het
Eps8 C T 6: 137,527,475 G87R probably damaging Het
Flg2 C A 3: 93,201,970 T435K possibly damaging Het
Gm16286 C T 18: 80,211,923 A144V probably damaging Het
Gpatch4 T C 3: 88,054,755 probably null Het
Heatr1 T A 13: 12,433,643 M1795K probably benign Het
Ift52 T C 2: 163,029,815 V189A probably benign Het
Kif21a T A 15: 90,993,855 D250V probably damaging Het
Lrrc66 T C 5: 73,608,279 T474A probably benign Het
Mcub T C 3: 129,915,716 E316G probably benign Het
Mettl15 C T 2: 109,191,622 V113I probably benign Het
Mroh8 T A 2: 157,221,230 I824F probably damaging Het
Mrpl19 A G 6: 81,962,011 M270T probably damaging Het
Olfr1187-ps1 T C 2: 88,540,255 Y58C probably null Het
Olfr33 T C 7: 102,713,682 T244A probably benign Het
Olfr559 A G 7: 102,723,917 V191A possibly damaging Het
Olfr561 A G 7: 102,775,433 K303R probably benign Het
Olfr628 T A 7: 103,732,189 W88R probably damaging Het
Olfr644 C A 7: 104,068,467 R188L possibly damaging Het
Olfr963 A T 9: 39,669,770 T238S probably damaging Het
Olfr986 T C 9: 40,187,784 I223T probably damaging Het
Olfr993 AAGTCTGGAGTC AAGTC 2: 85,414,713 probably null Het
Pacs1 T C 19: 5,147,207 M430V probably benign Het
Piezo2 A G 18: 63,145,105 S243P probably damaging Het
Ppp1r36 A T 12: 76,428,078 probably null Het
Prdm16 T A 4: 154,346,144 probably null Het
Prss36 A T 7: 127,934,233 W97R probably damaging Het
Psmg4 A T 13: 34,178,064 I112F probably damaging Het
Ptpru C T 4: 131,772,557 G1259R probably damaging Het
Rsph4a T C 10: 33,909,341 I416T possibly damaging Het
Scn2a C T 2: 65,701,756 R571C probably damaging Het
Selenbp1 A G 3: 94,944,416 M423V probably benign Het
Serpina3i G A 12: 104,268,492 A361T possibly damaging Het
Serpinb3c A T 1: 107,271,704 D362E probably damaging Het
Sf3a3 T C 4: 124,728,240 probably null Het
Slc3a2 T C 19: 8,713,644 K74R probably damaging Het
Smco1 T A 16: 32,273,876 W122R probably damaging Het
Snx19 A G 9: 30,427,973 K136E possibly damaging Het
Trim32 A G 4: 65,614,388 N394S probably damaging Het
Uqcrb T C 13: 66,900,825 D87G probably damaging Het
Wipf3 T C 6: 54,485,323 S173P possibly damaging Het
Zfp473 T C 7: 44,732,638 E756G probably damaging Het
Other mutations in Sgcg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Sgcg APN 14 61240347 nonsense probably null
IGL00159:Sgcg APN 14 61232475 missense probably benign 0.00
R0466:Sgcg UTSW 14 61221686 missense probably damaging 1.00
R1236:Sgcg UTSW 14 61245770 missense probably damaging 0.99
R1870:Sgcg UTSW 14 61240447 splice site probably benign
R1879:Sgcg UTSW 14 61236897 critical splice acceptor site probably null
R1933:Sgcg UTSW 14 61232412 missense possibly damaging 0.77
R2090:Sgcg UTSW 14 61245764 missense probably damaging 0.99
R2937:Sgcg UTSW 14 61229625 missense probably damaging 1.00
R2938:Sgcg UTSW 14 61229625 missense probably damaging 1.00
R3508:Sgcg UTSW 14 61221746 missense probably benign
R5345:Sgcg UTSW 14 61245769 missense probably damaging 0.99
R5582:Sgcg UTSW 14 61225305 missense probably damaging 1.00
R7259:Sgcg UTSW 14 61225217 missense probably benign 0.30
R7335:Sgcg UTSW 14 61240367 missense probably damaging 1.00
R8339:Sgcg UTSW 14 61232517 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCTAGAAGGCTCATGGTTTC -3'
(R):5'- GCAGCATCTTCAACTCAAAGG -3'

Sequencing Primer
(F):5'- CTAGAAGGCTCATGGTTTCTTATTTC -3'
(R):5'- GTGTGTGTATCACTAGGATCCTATAC -3'
Posted On2016-10-06