Incidental Mutation 'R5465:Vcpip1'
ID433188
Institutional Source Beutler Lab
Gene Symbol Vcpip1
Ensembl Gene ENSMUSG00000045210
Gene Namevalosin containing protein (p97)/p47 complex interacting protein 1
Synonyms5730421J18Rik, Vcip135, 5730538E15Rik
MMRRC Submission 043026-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.592) question?
Stock #R5465 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location9718622-9748382 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9747147 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 337 (H337R)
Ref Sequence ENSEMBL: ENSMUSP00000051248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057438]
Predicted Effect probably benign
Transcript: ENSMUST00000057438
AA Change: H337R

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000051248
Gene: ENSMUSG00000045210
AA Change: H337R

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
low complexity region 19 36 N/A INTRINSIC
Pfam:OTU 213 354 3.3e-15 PFAM
low complexity region 754 772 N/A INTRINSIC
low complexity region 1001 1015 N/A INTRINSIC
low complexity region 1161 1173 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181358
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181821
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189431
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207445
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209020
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a deubiquitinating enzyme that interacts with valosin containing protein p97 and plays a role in the assembly of Golgi apparatus during mitosis. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aplp1 T C 7: 30,436,852 D500G probably benign Het
Atg7 G A 6: 114,652,532 G4R probably benign Het
Atp11b G A 3: 35,810,184 V302I probably benign Het
Cacna1b C T 2: 24,650,426 probably null Het
Ccna1 T C 3: 55,045,644 H234R probably benign Het
Cplx2 G A 13: 54,379,539 E79K possibly damaging Het
Gnb2 A G 5: 137,528,513 I380T probably damaging Het
Gpr162 A T 6: 124,861,171 V172D probably damaging Het
Gtf2a1 A C 12: 91,567,791 F191V possibly damaging Het
Ift172 A T 5: 31,261,518 probably null Het
Khdrbs2 T C 1: 32,619,174 Y272H probably damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Map1a T C 2: 121,306,025 S2203P probably damaging Het
Map3k1 A T 13: 111,756,120 L867Q probably benign Het
Ncapd2 A T 6: 125,176,783 F656L probably damaging Het
Olfr1356 T C 10: 78,847,018 K299R probably benign Het
Olfr1463 T C 19: 13,234,688 I146T probably benign Het
Olfr561 A G 7: 102,775,433 K303R probably benign Het
Pcdhb6 A T 18: 37,334,730 I235F probably damaging Het
Pzp A G 6: 128,486,961 S1395P probably damaging Het
Ralgapb C A 2: 158,448,405 T412N possibly damaging Het
Rtn4r A T 16: 18,151,427 M240L probably benign Het
Slit2 C T 5: 48,249,912 T895I probably damaging Het
Slx4ip T G 2: 137,004,947 L44R probably damaging Het
Sptbn2 C A 19: 4,750,105 Q2196K probably benign Het
Tbc1d16 G A 11: 119,156,059 S454L probably benign Het
Tet1 T C 10: 62,839,777 H840R probably benign Het
Usp47 C T 7: 112,059,002 T176M probably damaging Het
Utp6 A T 11: 79,949,010 I284N probably benign Het
Wdr78 T A 4: 103,049,561 D685V probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Vcpip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02341:Vcpip1 APN 1 9724950 missense possibly damaging 0.75
IGL02888:Vcpip1 APN 1 9724786 missense probably damaging 0.98
IGL03246:Vcpip1 APN 1 9745957 missense probably benign 0.00
R0243:Vcpip1 UTSW 1 9747206 nonsense probably null
R0968:Vcpip1 UTSW 1 9746379 missense probably damaging 1.00
R1139:Vcpip1 UTSW 1 9746723 missense probably damaging 0.98
R1230:Vcpip1 UTSW 1 9725224 missense probably damaging 1.00
R1524:Vcpip1 UTSW 1 9724502 missense probably damaging 1.00
R1989:Vcpip1 UTSW 1 9745563 missense probably benign 0.11
R2135:Vcpip1 UTSW 1 9747810 missense probably benign 0.01
R2299:Vcpip1 UTSW 1 9745719 missense possibly damaging 0.71
R4692:Vcpip1 UTSW 1 9748074 missense unknown
R4855:Vcpip1 UTSW 1 9747364 missense probably damaging 1.00
R4883:Vcpip1 UTSW 1 9747198 missense probably damaging 1.00
R4891:Vcpip1 UTSW 1 9748062 missense unknown
R4897:Vcpip1 UTSW 1 9747347 missense probably damaging 0.97
R5141:Vcpip1 UTSW 1 9748077 missense unknown
R5651:Vcpip1 UTSW 1 9747840 missense probably damaging 0.99
R5664:Vcpip1 UTSW 1 9746379 missense probably damaging 0.99
R6131:Vcpip1 UTSW 1 9747292 missense probably damaging 0.99
R6187:Vcpip1 UTSW 1 9724780 missense probably damaging 1.00
R7042:Vcpip1 UTSW 1 9748153 missense unknown
R7268:Vcpip1 UTSW 1 9746082 missense probably damaging 0.99
R7417:Vcpip1 UTSW 1 9746315 missense probably benign 0.00
R7464:Vcpip1 UTSW 1 9746520 missense probably damaging 0.99
R8138:Vcpip1 UTSW 1 9748109 small deletion probably benign
R8350:Vcpip1 UTSW 1 9724606 missense probably benign
R8450:Vcpip1 UTSW 1 9724606 missense probably benign
Z1177:Vcpip1 UTSW 1 9747082 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATCCTCCTCAAGCTTGATG -3'
(R):5'- ATGACTTTATTGATGCTGCCGAG -3'

Sequencing Primer
(F):5'- GTACTTTTTAATAAGGTCCTGAGGC -3'
(R):5'- CAATGAATGTGACCCTCTGTTTG -3'
Posted On2016-10-06