Incidental Mutation 'R0479:Cct8'
ID43319
Institutional Source Beutler Lab
Gene Symbol Cct8
Ensembl Gene ENSMUSG00000025613
Gene Namechaperonin containing Tcp1, subunit 8 (theta)
SynonymsCctq, Tcpq
MMRRC Submission 038679-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R0479 (G1)
Quality Score225
Status Validated (trace)
Chromosome16
Chromosomal Location87483326-87495873 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 87487706 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 198 (V198M)
Ref Sequence ENSEMBL: ENSMUSP00000135651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026704] [ENSMUST00000026710] [ENSMUST00000119504] [ENSMUST00000144759] [ENSMUST00000175977] [ENSMUST00000176041] [ENSMUST00000176750] [ENSMUST00000177376]
Predicted Effect probably damaging
Transcript: ENSMUST00000026704
AA Change: V257M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026704
Gene: ENSMUSG00000025613
AA Change: V257M

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 39 529 6.7e-156 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026710
SMART Domains Protein: ENSMUSP00000026710
Gene: ENSMUSG00000025616

DomainStartEndE-ValueType
Pfam:zf-UBP 48 127 2.5e-23 PFAM
coiled coil region 149 182 N/A INTRINSIC
Pfam:UCH 194 821 2e-54 PFAM
Pfam:UCH_1 195 800 3.8e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119504
SMART Domains Protein: ENSMUSP00000114058
Gene: ENSMUSG00000025616

DomainStartEndE-ValueType
Pfam:zf-UBP 48 127 6.9e-24 PFAM
coiled coil region 149 181 N/A INTRINSIC
Pfam:UCH 193 732 1.2e-36 PFAM
Pfam:UCH_1 194 737 2.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144759
SMART Domains Protein: ENSMUSP00000116323
Gene: ENSMUSG00000025616

DomainStartEndE-ValueType
Pfam:zf-UBP 48 127 2e-24 PFAM
coiled coil region 149 181 N/A INTRINSIC
Pfam:UCH 193 330 2.4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149656
Predicted Effect unknown
Transcript: ENSMUST00000175750
AA Change: V15M
SMART Domains Protein: ENSMUSP00000134920
Gene: ENSMUSG00000025613
AA Change: V15M

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 1 238 1.2e-69 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000175977
AA Change: V198M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135651
Gene: ENSMUSG00000025613
AA Change: V198M

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 39 132 4.5e-32 PFAM
Pfam:Cpn60_TCP1 120 470 1.9e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176041
SMART Domains Protein: ENSMUSP00000135377
Gene: ENSMUSG00000025613

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 1 158 3.3e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176241
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176589
Predicted Effect probably benign
Transcript: ENSMUST00000176750
SMART Domains Protein: ENSMUSP00000135830
Gene: ENSMUSG00000025613

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 1 132 1.7e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177301
Predicted Effect probably benign
Transcript: ENSMUST00000177376
SMART Domains Protein: ENSMUSP00000135498
Gene: ENSMUSG00000025613

DomainStartEndE-ValueType
PDB:4B2T|Q 1 51 1e-29 PDB
SCOP:d1oela1 26 51 8e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177485
Meta Mutation Damage Score 0.4624 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 98% (105/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the theta subunit of the CCT chaperonin, which is abundant in the eukaryotic cytosol and may be involved in the transport and assembly of newly synthesized proteins. Alternative splicing results in multiple transcript variants of this gene. A pseudogene related to this gene is located on chromosome 1. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 A G 1: 173,332,145 V269A probably benign Het
Acsl1 G A 8: 46,531,072 G543R probably damaging Het
Adam18 T C 8: 24,651,822 N244D probably benign Het
Adgra3 C T 5: 49,990,265 V478M probably benign Het
Arhgap39 C T 15: 76,734,886 D833N probably damaging Het
Arhgef10 A T 8: 14,991,070 E723V probably damaging Het
Arid3a C A 10: 79,951,294 N519K possibly damaging Het
Atrn T A 2: 130,999,165 Y1162* probably null Het
Cacng5 T A 11: 107,877,951 N172Y probably benign Het
Cep192 G A 18: 67,858,018 S1857N probably damaging Het
Cherp A T 8: 72,463,147 D657E possibly damaging Het
Clca2 T G 3: 145,090,849 D199A probably damaging Het
Cops7b A G 1: 86,605,076 T219A probably benign Het
Crb1 C T 1: 139,198,614 M1392I probably damaging Het
Csf3r A C 4: 126,043,823 E833D probably damaging Het
Cutc A G 19: 43,768,216 E247G probably damaging Het
Cyp2c38 A G 19: 39,463,005 L17P probably damaging Het
D430042O09Rik T C 7: 125,843,346 L809S probably benign Het
D5Ertd615e T A 5: 45,163,454 noncoding transcript Het
Ddx60 G T 8: 61,969,657 G643W probably damaging Het
Depdc1a C T 3: 159,520,860 T268I probably damaging Het
Dgke T C 11: 89,052,470 E231G probably benign Het
Dhrs7b T A 11: 60,855,687 probably benign Het
Dll3 A G 7: 28,301,549 V27A probably damaging Het
Dnmt3c T A 2: 153,714,941 probably null Het
Duox1 T C 2: 122,346,380 F1461L probably damaging Het
Enpep A G 3: 129,312,674 V301A possibly damaging Het
Eny2 T A 15: 44,435,604 probably null Het
Esr1 A G 10: 4,997,911 D488G probably damaging Het
Ets1 A G 9: 32,730,180 K110E probably damaging Het
Eya2 T A 2: 165,715,956 Y157* probably null Het
F830045P16Rik T G 2: 129,472,688 D223A possibly damaging Het
Fbxo18 A G 2: 11,758,419 Y475H probably damaging Het
Fbxo39 T C 11: 72,317,593 I257T probably damaging Het
Fkbp10 T C 11: 100,415,914 V23A probably damaging Het
Foxp3 A G X: 7,587,344 I128V possibly damaging Het
Fzd7 T C 1: 59,483,708 F250S probably damaging Het
Gaa A G 11: 119,281,236 T722A possibly damaging Het
Gemin5 A G 11: 58,139,551 V816A probably benign Het
Glb1l3 T A 9: 26,829,093 T314S probably benign Het
H2-Ab1 A G 17: 34,264,968 E101G possibly damaging Het
Hydin A C 8: 110,599,088 T4710P probably damaging Het
Ica1 C T 6: 8,754,627 V48M probably damaging Het
Ica1 T C 6: 8,754,683 Y29C probably damaging Het
Ints7 T A 1: 191,614,554 probably null Het
Iqub T C 6: 24,505,810 E33G probably benign Het
Itgb1bp2 T A X: 101,449,200 C10S probably damaging Het
Kcnd1 T A X: 7,831,222 I391N possibly damaging Het
Kdm8 T C 7: 125,452,640 L135P probably damaging Het
Ksr1 T C 11: 79,025,283 D574G probably damaging Het
Lama5 C T 2: 180,184,457 R2331H probably benign Het
Larp1 C A 11: 58,042,820 N357K possibly damaging Het
Lgi3 C T 14: 70,534,552 probably benign Het
Lmbrd1 T A 1: 24,746,797 probably benign Het
Methig1 A T 15: 100,374,944 K53* probably null Het
Mfap3 T A 11: 57,529,643 I150N probably damaging Het
Mug1 A T 6: 121,840,227 Q85L probably benign Het
Npl A G 1: 153,515,409 V200A probably damaging Het
Nuf2 A T 1: 169,498,934 probably benign Het
Obscn A G 11: 59,112,707 V1255A probably damaging Het
Olfr186 C T 16: 59,027,128 V260M possibly damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr916 T C 9: 38,658,182 D70G probably damaging Het
P2rx1 T C 11: 73,012,961 V283A probably damaging Het
Pex2 C A 3: 5,561,295 L151F probably damaging Het
Pias1 A G 9: 62,893,118 probably benign Het
Pmfbp1 A T 8: 109,530,473 probably benign Het
Pogz A G 3: 94,876,636 K545E possibly damaging Het
Ppp3cb T C 14: 20,503,241 probably null Het
Prl G A 13: 27,064,928 D189N probably damaging Het
Prpf6 A G 2: 181,651,127 N794S probably benign Het
Prr36 G A 8: 4,213,930 Q579* probably null Het
Ptprq A T 10: 107,643,994 Y1138* probably null Het
Rabepk A T 2: 34,785,580 H179Q probably damaging Het
Rest T C 5: 77,282,751 S1006P probably damaging Het
Rimklb A C 6: 122,464,216 probably benign Het
Rnpepl1 T C 1: 92,918,865 probably benign Het
Sacs T A 14: 61,191,479 L329Q probably damaging Het
Safb C T 17: 56,606,025 R914C probably damaging Het
Setd5 A T 6: 113,115,033 I272F probably damaging Het
Sgk1 G T 10: 21,996,310 A262S probably benign Het
Skint2 G A 4: 112,624,041 V34I possibly damaging Het
Skint5 G C 4: 113,655,672 Q888E unknown Het
Slc4a3 T C 1: 75,551,828 probably benign Het
Sox10 T C 15: 79,163,319 E133G probably damaging Het
Spryd3 G A 15: 102,130,400 R129* probably null Het
Stag1 T A 9: 100,928,091 N782K probably benign Het
Stam T C 2: 14,117,495 L132P probably damaging Het
Stard9 T A 2: 120,697,596 S1445T probably damaging Het
Syt5 C T 7: 4,543,109 R94Q probably benign Het
Tbc1d23 A T 16: 57,171,814 H594Q probably damaging Het
Tecta T A 9: 42,337,939 I1871F probably damaging Het
Tek A G 4: 94,804,312 D219G probably benign Het
Thrb T C 14: 18,033,643 F469L probably damaging Het
Trove2 A T 1: 143,757,751 D536E possibly damaging Het
Tyr T C 7: 87,493,221 S44G possibly damaging Het
Usp20 T A 2: 31,017,475 V673E probably benign Het
Usp28 T C 9: 49,037,213 S873P probably damaging Het
Usp43 C T 11: 67,897,274 V306M possibly damaging Het
Wdr17 G T 8: 54,651,421 probably null Het
Wsb2 T G 5: 117,376,679 probably benign Het
Xkrx A T X: 134,150,966 L312Q probably damaging Het
Other mutations in Cct8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02054:Cct8 APN 16 87490476 splice site probably benign
IGL02975:Cct8 APN 16 87486230 splice site probably benign
IGL03015:Cct8 APN 16 87486665 splice site probably benign
IGL03191:Cct8 APN 16 87486310 missense probably damaging 1.00
PIT4151001:Cct8 UTSW 16 87487657 missense probably damaging 1.00
R0972:Cct8 UTSW 16 87486620 missense possibly damaging 0.94
R1368:Cct8 UTSW 16 87491312 missense probably damaging 0.99
R1544:Cct8 UTSW 16 87491454 splice site probably benign
R1548:Cct8 UTSW 16 87485584 missense probably damaging 0.99
R1823:Cct8 UTSW 16 87490554 nonsense probably null
R2303:Cct8 UTSW 16 87490332 unclassified probably null
R3076:Cct8 UTSW 16 87488877 missense possibly damaging 0.84
R3078:Cct8 UTSW 16 87488877 missense possibly damaging 0.84
R4094:Cct8 UTSW 16 87487628 missense possibly damaging 0.94
R4713:Cct8 UTSW 16 87487688 nonsense probably null
R5031:Cct8 UTSW 16 87487538 missense probably damaging 0.99
R5687:Cct8 UTSW 16 87488821 missense probably benign 0.00
R6325:Cct8 UTSW 16 87495727 critical splice donor site probably null
R6391:Cct8 UTSW 16 87487678 missense probably benign 0.00
R6395:Cct8 UTSW 16 87486476 nonsense probably null
R7252:Cct8 UTSW 16 87484919 missense probably benign 0.01
R7570:Cct8 UTSW 16 87491322 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- AGCATAATGAAGAGCTATGTCCGCC -3'
(R):5'- CCTAAAGGAAATCTGTCCCTGCCAC -3'

Sequencing Primer
(F):5'- AGAGCTATGTCCGCCACTTTG -3'
(R):5'- TGTCCCTGCCACATTGAAAAC -3'
Posted On2013-05-23