Incidental Mutation 'R5465:Khdrbs2'
ID433190
Institutional Source Beutler Lab
Gene Symbol Khdrbs2
Ensembl Gene ENSMUSG00000026058
Gene NameKH domain containing, RNA binding, signal transduction associated 2
Synonyms6330586C16Rik, SLM-1
MMRRC Submission 043026-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.317) question?
Stock #R5465 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location32172714-32658568 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32619174 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 272 (Y272H)
Ref Sequence ENSEMBL: ENSMUSP00000027226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027226]
Predicted Effect probably damaging
Transcript: ENSMUST00000027226
AA Change: Y272H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027226
Gene: ENSMUSG00000026058
AA Change: Y272H

DomainStartEndE-ValueType
low complexity region 41 48 N/A INTRINSIC
KH 58 156 4.93e-7 SMART
low complexity region 185 197 N/A INTRINSIC
low complexity region 204 231 N/A INTRINSIC
Pfam:Sam68-YY 267 321 1.3e-22 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is similar to the src associated in mitosis, 68 kDa protein, which is an RNA-binding protein and a substrate for Src-family tyrosine kinases during mitosis. This protein has a KH RNA-binding motif and proline-rich motifs which may be SH2 and SH3 domain binding sites. A similar rat protein is an RNA-binding protein which is tyrosine phosphorylated by Src during mitosis. These studies also suggest that the rat protein may function as an adaptor protein for Src by binding the SH2 and SH3 domains of various other proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant animals display smaller brain size and reduced weight in the cerebellum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aplp1 T C 7: 30,436,852 D500G probably benign Het
Atg7 G A 6: 114,652,532 G4R probably benign Het
Atp11b G A 3: 35,810,184 V302I probably benign Het
Cacna1b C T 2: 24,650,426 probably null Het
Ccna1 T C 3: 55,045,644 H234R probably benign Het
Cplx2 G A 13: 54,379,539 E79K possibly damaging Het
Gnb2 A G 5: 137,528,513 I380T probably damaging Het
Gpr162 A T 6: 124,861,171 V172D probably damaging Het
Gtf2a1 A C 12: 91,567,791 F191V possibly damaging Het
Ift172 A T 5: 31,261,518 probably null Het
Kmt2d G A 15: 98,852,109 probably benign Het
Map1a T C 2: 121,306,025 S2203P probably damaging Het
Map3k1 A T 13: 111,756,120 L867Q probably benign Het
Ncapd2 A T 6: 125,176,783 F656L probably damaging Het
Olfr1356 T C 10: 78,847,018 K299R probably benign Het
Olfr1463 T C 19: 13,234,688 I146T probably benign Het
Olfr561 A G 7: 102,775,433 K303R probably benign Het
Pcdhb6 A T 18: 37,334,730 I235F probably damaging Het
Pzp A G 6: 128,486,961 S1395P probably damaging Het
Ralgapb C A 2: 158,448,405 T412N possibly damaging Het
Rtn4r A T 16: 18,151,427 M240L probably benign Het
Slit2 C T 5: 48,249,912 T895I probably damaging Het
Slx4ip T G 2: 137,004,947 L44R probably damaging Het
Sptbn2 C A 19: 4,750,105 Q2196K probably benign Het
Tbc1d16 G A 11: 119,156,059 S454L probably benign Het
Tet1 T C 10: 62,839,777 H840R probably benign Het
Usp47 C T 7: 112,059,002 T176M probably damaging Het
Utp6 A T 11: 79,949,010 I284N probably benign Het
Vcpip1 T C 1: 9,747,147 H337R probably benign Het
Wdr78 T A 4: 103,049,561 D685V probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Khdrbs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Khdrbs2 APN 1 32472752 missense probably benign 0.00
IGL01326:Khdrbs2 APN 1 32657477 missense possibly damaging 0.94
IGL01767:Khdrbs2 APN 1 32619176 nonsense probably null
IGL01792:Khdrbs2 APN 1 32657467 missense probably damaging 0.99
IGL01839:Khdrbs2 APN 1 32414862 splice site probably benign
R0046:Khdrbs2 UTSW 1 32619202 missense possibly damaging 0.56
R0079:Khdrbs2 UTSW 1 32519915 splice site probably null
R0396:Khdrbs2 UTSW 1 32519973 missense probably damaging 1.00
R0613:Khdrbs2 UTSW 1 32657522 missense possibly damaging 0.94
R0616:Khdrbs2 UTSW 1 32467775 missense possibly damaging 0.65
R1034:Khdrbs2 UTSW 1 32467791 missense probably damaging 1.00
R1055:Khdrbs2 UTSW 1 32644157 splice site probably benign
R1156:Khdrbs2 UTSW 1 32467875 missense probably benign 0.04
R1456:Khdrbs2 UTSW 1 32520696 missense possibly damaging 0.71
R2007:Khdrbs2 UTSW 1 32520548 missense probably benign 0.04
R2079:Khdrbs2 UTSW 1 32467874 missense probably benign
R2384:Khdrbs2 UTSW 1 32519895 missense probably damaging 0.97
R3123:Khdrbs2 UTSW 1 32519777 missense probably damaging 0.98
R3124:Khdrbs2 UTSW 1 32519777 missense probably damaging 0.98
R3772:Khdrbs2 UTSW 1 32244076 nonsense probably null
R4078:Khdrbs2 UTSW 1 32519814 intron probably benign
R4088:Khdrbs2 UTSW 1 32333524 missense probably damaging 1.00
R4955:Khdrbs2 UTSW 1 32520077 intron probably benign
R5668:Khdrbs2 UTSW 1 32467770 missense probably damaging 1.00
R5792:Khdrbs2 UTSW 1 32472692 missense probably damaging 1.00
R6639:Khdrbs2 UTSW 1 32467862 nonsense probably null
R7027:Khdrbs2 UTSW 1 32414916 missense probably benign 0.02
R7380:Khdrbs2 UTSW 1 32333604 missense unknown
R7381:Khdrbs2 UTSW 1 32333802 missense not run
R7939:Khdrbs2 UTSW 1 32172975 missense probably benign 0.27
R8087:Khdrbs2 UTSW 1 32414976 missense probably benign 0.11
X0020:Khdrbs2 UTSW 1 32414974 missense probably damaging 1.00
Z1088:Khdrbs2 UTSW 1 32244055 intron probably benign
Z1176:Khdrbs2 UTSW 1 32333662 missense unknown
Z1177:Khdrbs2 UTSW 1 32243967 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- GGTGTTTCTCTATCATTGAAGACTGAG -3'
(R):5'- GGAGATTAAATCCACTGCTTAAAACCC -3'

Sequencing Primer
(F):5'- ACACACACAAATGTTTTCCTCATC -3'
(R):5'- CCACTGCTTAAAACCCTCATATAATC -3'
Posted On2016-10-06