Incidental Mutation 'R0479:H2-Ab1'
ID43320
Institutional Source Beutler Lab
Gene Symbol H2-Ab1
Ensembl Gene ENSMUSG00000073421
Gene Namehistocompatibility 2, class II antigen A, beta 1
SynonymsA beta, Abeta, Ia-2, IAb, Rmcs1, I-A, H-2Ab, I-Abeta, Ia2, H2-Ab
MMRRC Submission 038679-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R0479 (G1)
Quality Score191
Status Validated (trace)
Chromosome17
Chromosomal Location34263209-34269418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34264968 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 101 (E101G)
Ref Sequence ENSEMBL: ENSMUSP00000041008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040828]
PDB Structure
CRYSTAL STRUCTURE OF CLASS II MHC MOLECULE IAb BOUND TO EALPHA3K PEPTIDE [X-RAY DIFFRACTION]
Crystal structure of murine class II MHC I-Ab in complex with a human CLIP peptide [X-RAY DIFFRACTION]
Crystal structure of mouse MHC class II I-Ab/3K peptide complexed with mouse TCR B3K506 [X-RAY DIFFRACTION]
Crystal structure of mouse MHC class II I-Ab/3K peptide complexed with mouse TCR YAe62 [X-RAY DIFFRACTION]
Crystal structure of mouse MHC class II I-Ab/3K peptide complexed with mouse TCR 2W20 [X-RAY DIFFRACTION]
Crystal Structure of 809.B5 TCR complexed with MHC Class II I-Ab/3k peptide [X-RAY DIFFRACTION]
J809.B5 TCR bound to IAb/3K [X-RAY DIFFRACTION]
J809.B5 Y31A TCR bound to IAb3K [X-RAY DIFFRACTION]
14.C6 TCR complexed with MHC class II I-Ab/3K peptide [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040828
AA Change: E101G

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000041008
Gene: ENSMUSG00000073421
AA Change: E101G

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
MHC_II_beta 40 114 1.53e-47 SMART
IGc1 140 211 8.47e-34 SMART
transmembrane domain 228 247 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174875
Meta Mutation Damage Score 0.1512 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 98% (105/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HLA-DQB1 belongs to the HLA class II beta chain paralogs. This class II molecule is a heterodimer consisting of an alpha (DQA) and a beta chain (DQB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa and it contains six exons. Exon 1 encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DQ molecule both the alpha chain and the beta chain contain the polymorphisms specifying the peptide binding specificities, resulting in up to four different molecules. Typing for these polymorphisms is routinely done for bone marrow transplantation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit depletion of mature CD4+ T cells, deficiency in cell-mediated immune responses, and increased susceptibility to viral infections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 A G 1: 173,332,145 V269A probably benign Het
Acsl1 G A 8: 46,531,072 G543R probably damaging Het
Adam18 T C 8: 24,651,822 N244D probably benign Het
Adgra3 C T 5: 49,990,265 V478M probably benign Het
Arhgap39 C T 15: 76,734,886 D833N probably damaging Het
Arhgef10 A T 8: 14,991,070 E723V probably damaging Het
Arid3a C A 10: 79,951,294 N519K possibly damaging Het
Atrn T A 2: 130,999,165 Y1162* probably null Het
Cacng5 T A 11: 107,877,951 N172Y probably benign Het
Cct8 C T 16: 87,487,706 V198M probably damaging Het
Cep192 G A 18: 67,858,018 S1857N probably damaging Het
Cherp A T 8: 72,463,147 D657E possibly damaging Het
Clca2 T G 3: 145,090,849 D199A probably damaging Het
Cops7b A G 1: 86,605,076 T219A probably benign Het
Crb1 C T 1: 139,198,614 M1392I probably damaging Het
Csf3r A C 4: 126,043,823 E833D probably damaging Het
Cutc A G 19: 43,768,216 E247G probably damaging Het
Cyp2c38 A G 19: 39,463,005 L17P probably damaging Het
D430042O09Rik T C 7: 125,843,346 L809S probably benign Het
D5Ertd615e T A 5: 45,163,454 noncoding transcript Het
Ddx60 G T 8: 61,969,657 G643W probably damaging Het
Depdc1a C T 3: 159,520,860 T268I probably damaging Het
Dgke T C 11: 89,052,470 E231G probably benign Het
Dhrs7b T A 11: 60,855,687 probably benign Het
Dll3 A G 7: 28,301,549 V27A probably damaging Het
Dnmt3c T A 2: 153,714,941 probably null Het
Duox1 T C 2: 122,346,380 F1461L probably damaging Het
Enpep A G 3: 129,312,674 V301A possibly damaging Het
Eny2 T A 15: 44,435,604 probably null Het
Esr1 A G 10: 4,997,911 D488G probably damaging Het
Ets1 A G 9: 32,730,180 K110E probably damaging Het
Eya2 T A 2: 165,715,956 Y157* probably null Het
F830045P16Rik T G 2: 129,472,688 D223A possibly damaging Het
Fbxo18 A G 2: 11,758,419 Y475H probably damaging Het
Fbxo39 T C 11: 72,317,593 I257T probably damaging Het
Fkbp10 T C 11: 100,415,914 V23A probably damaging Het
Foxp3 A G X: 7,587,344 I128V possibly damaging Het
Fzd7 T C 1: 59,483,708 F250S probably damaging Het
Gaa A G 11: 119,281,236 T722A possibly damaging Het
Gemin5 A G 11: 58,139,551 V816A probably benign Het
Glb1l3 T A 9: 26,829,093 T314S probably benign Het
Hydin A C 8: 110,599,088 T4710P probably damaging Het
Ica1 C T 6: 8,754,627 V48M probably damaging Het
Ica1 T C 6: 8,754,683 Y29C probably damaging Het
Ints7 T A 1: 191,614,554 probably null Het
Iqub T C 6: 24,505,810 E33G probably benign Het
Itgb1bp2 T A X: 101,449,200 C10S probably damaging Het
Kcnd1 T A X: 7,831,222 I391N possibly damaging Het
Kdm8 T C 7: 125,452,640 L135P probably damaging Het
Ksr1 T C 11: 79,025,283 D574G probably damaging Het
Lama5 C T 2: 180,184,457 R2331H probably benign Het
Larp1 C A 11: 58,042,820 N357K possibly damaging Het
Lgi3 C T 14: 70,534,552 probably benign Het
Lmbrd1 T A 1: 24,746,797 probably benign Het
Methig1 A T 15: 100,374,944 K53* probably null Het
Mfap3 T A 11: 57,529,643 I150N probably damaging Het
Mug1 A T 6: 121,840,227 Q85L probably benign Het
Npl A G 1: 153,515,409 V200A probably damaging Het
Nuf2 A T 1: 169,498,934 probably benign Het
Obscn A G 11: 59,112,707 V1255A probably damaging Het
Olfr186 C T 16: 59,027,128 V260M possibly damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr916 T C 9: 38,658,182 D70G probably damaging Het
P2rx1 T C 11: 73,012,961 V283A probably damaging Het
Pex2 C A 3: 5,561,295 L151F probably damaging Het
Pias1 A G 9: 62,893,118 probably benign Het
Pmfbp1 A T 8: 109,530,473 probably benign Het
Pogz A G 3: 94,876,636 K545E possibly damaging Het
Ppp3cb T C 14: 20,503,241 probably null Het
Prl G A 13: 27,064,928 D189N probably damaging Het
Prpf6 A G 2: 181,651,127 N794S probably benign Het
Prr36 G A 8: 4,213,930 Q579* probably null Het
Ptprq A T 10: 107,643,994 Y1138* probably null Het
Rabepk A T 2: 34,785,580 H179Q probably damaging Het
Rest T C 5: 77,282,751 S1006P probably damaging Het
Rimklb A C 6: 122,464,216 probably benign Het
Rnpepl1 T C 1: 92,918,865 probably benign Het
Sacs T A 14: 61,191,479 L329Q probably damaging Het
Safb C T 17: 56,606,025 R914C probably damaging Het
Setd5 A T 6: 113,115,033 I272F probably damaging Het
Sgk1 G T 10: 21,996,310 A262S probably benign Het
Skint2 G A 4: 112,624,041 V34I possibly damaging Het
Skint5 G C 4: 113,655,672 Q888E unknown Het
Slc4a3 T C 1: 75,551,828 probably benign Het
Sox10 T C 15: 79,163,319 E133G probably damaging Het
Spryd3 G A 15: 102,130,400 R129* probably null Het
Stag1 T A 9: 100,928,091 N782K probably benign Het
Stam T C 2: 14,117,495 L132P probably damaging Het
Stard9 T A 2: 120,697,596 S1445T probably damaging Het
Syt5 C T 7: 4,543,109 R94Q probably benign Het
Tbc1d23 A T 16: 57,171,814 H594Q probably damaging Het
Tecta T A 9: 42,337,939 I1871F probably damaging Het
Tek A G 4: 94,804,312 D219G probably benign Het
Thrb T C 14: 18,033,643 F469L probably damaging Het
Trove2 A T 1: 143,757,751 D536E possibly damaging Het
Tyr T C 7: 87,493,221 S44G possibly damaging Het
Usp20 T A 2: 31,017,475 V673E probably benign Het
Usp28 T C 9: 49,037,213 S873P probably damaging Het
Usp43 C T 11: 67,897,274 V306M possibly damaging Het
Wdr17 G T 8: 54,651,421 probably null Het
Wsb2 T G 5: 117,376,679 probably benign Het
Xkrx A T X: 134,150,966 L312Q probably damaging Het
Other mutations in H2-Ab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:H2-Ab1 APN 17 34267575 missense probably damaging 1.00
IGL01941:H2-Ab1 APN 17 34267434 nonsense probably null
IGL02826:H2-Ab1 APN 17 34264911 missense probably damaging 0.98
R0815:H2-Ab1 UTSW 17 34267354 missense probably damaging 0.99
R0863:H2-Ab1 UTSW 17 34267354 missense probably damaging 0.99
R1796:H2-Ab1 UTSW 17 34267372 missense probably damaging 0.99
R2875:H2-Ab1 UTSW 17 34263312 start codon destroyed probably benign 0.21
R4042:H2-Ab1 UTSW 17 34264860 missense probably benign
R4687:H2-Ab1 UTSW 17 34264809 missense probably damaging 0.99
R4761:H2-Ab1 UTSW 17 34267500 missense probably damaging 0.98
R4787:H2-Ab1 UTSW 17 34267467 missense possibly damaging 0.92
R5111:H2-Ab1 UTSW 17 34267482 missense probably damaging 0.96
R5155:H2-Ab1 UTSW 17 34267384 missense possibly damaging 0.89
R5194:H2-Ab1 UTSW 17 34269378 utr 3 prime probably benign
R6869:H2-Ab1 UTSW 17 34267563 missense probably damaging 1.00
R7037:H2-Ab1 UTSW 17 34267989 missense probably damaging 0.99
R7054:H2-Ab1 UTSW 17 34263342 missense probably benign 0.41
R7250:H2-Ab1 UTSW 17 34267507 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGCGCATACGATATGTGACCAG -3'
(R):5'- ATGACAGTGATGCCTTCGGGTCAG -3'

Sequencing Primer
(F):5'- GCATACGATATGTGACCAGATACATC -3'
(R):5'- GCGCTAAACCGCTTCTGAC -3'
Posted On2013-05-23