Incidental Mutation 'R5465:Atg7'
ID433203
Institutional Source Beutler Lab
Gene Symbol Atg7
Ensembl Gene ENSMUSG00000030314
Gene Nameautophagy related 7
Synonyms1810013K23Rik, Apg7l
MMRRC Submission 043026-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5465 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location114643097-114860614 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 114652532 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 4 (G4R)
Ref Sequence ENSEMBL: ENSMUSP00000138358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032457] [ENSMUST00000169310] [ENSMUST00000182034] [ENSMUST00000182035] [ENSMUST00000182098] [ENSMUST00000182169] [ENSMUST00000182428] [ENSMUST00000182510] [ENSMUST00000182793] [ENSMUST00000182902] [ENSMUST00000183165]
Predicted Effect probably benign
Transcript: ENSMUST00000032457
SMART Domains Protein: ENSMUSP00000032457
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
Pfam:ThiF 350 506 1.6e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169310
SMART Domains Protein: ENSMUSP00000133215
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
Pfam:ATG7_N 9 319 1.5e-106 PFAM
Pfam:ThiF 329 643 7.9e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182034
AA Change: G4R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138358
Gene: ENSMUSG00000030314
AA Change: G4R

DomainStartEndE-ValueType
PDB:3VX8|A 25 231 1e-39 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000182035
SMART Domains Protein: ENSMUSP00000138731
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
PDB:3VX8|A 9 222 9e-40 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000182098
Predicted Effect probably benign
Transcript: ENSMUST00000182169
SMART Domains Protein: ENSMUSP00000138404
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
PDB:3VX8|A 32 110 2e-9 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000182428
SMART Domains Protein: ENSMUSP00000138779
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
Pfam:ThiF 350 506 1.1e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182510
SMART Domains Protein: ENSMUSP00000138300
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
PDB:3VX8|A 9 159 8e-37 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000182793
SMART Domains Protein: ENSMUSP00000138137
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
Pfam:ThiF 350 506 1.6e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182902
SMART Domains Protein: ENSMUSP00000138651
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
Pfam:ThiF 350 506 1.6e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183127
Predicted Effect probably benign
Transcript: ENSMUST00000183165
SMART Domains Protein: ENSMUSP00000138600
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
Pfam:ThiF 311 467 9.7e-38 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an E1-like activating enzyme that is essential for autophagy and cytoplasmic to vacuole transport. The encoded protein is also thought to modulate p53-dependent cell cycle pathways during prolonged metabolic stress. It has been associated with multiple functions, including axon membrane trafficking, axonal homeostasis, mitophagy, adipose differentiation, and hematopoietic stem cell maintenance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutation of this gene causes impairment of constitutive and starvation-induced autophagy resulting in defective protein degradation. Homozygous null mice die within 1 day of birth and have decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aplp1 T C 7: 30,436,852 D500G probably benign Het
Atp11b G A 3: 35,810,184 V302I probably benign Het
Cacna1b C T 2: 24,650,426 probably null Het
Ccna1 T C 3: 55,045,644 H234R probably benign Het
Cplx2 G A 13: 54,379,539 E79K possibly damaging Het
Gnb2 A G 5: 137,528,513 I380T probably damaging Het
Gpr162 A T 6: 124,861,171 V172D probably damaging Het
Gtf2a1 A C 12: 91,567,791 F191V possibly damaging Het
Ift172 A T 5: 31,261,518 probably null Het
Khdrbs2 T C 1: 32,619,174 Y272H probably damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Map1a T C 2: 121,306,025 S2203P probably damaging Het
Map3k1 A T 13: 111,756,120 L867Q probably benign Het
Ncapd2 A T 6: 125,176,783 F656L probably damaging Het
Olfr1356 T C 10: 78,847,018 K299R probably benign Het
Olfr1463 T C 19: 13,234,688 I146T probably benign Het
Olfr561 A G 7: 102,775,433 K303R probably benign Het
Pcdhb6 A T 18: 37,334,730 I235F probably damaging Het
Pzp A G 6: 128,486,961 S1395P probably damaging Het
Ralgapb C A 2: 158,448,405 T412N possibly damaging Het
Rtn4r A T 16: 18,151,427 M240L probably benign Het
Slit2 C T 5: 48,249,912 T895I probably damaging Het
Slx4ip T G 2: 137,004,947 L44R probably damaging Het
Sptbn2 C A 19: 4,750,105 Q2196K probably benign Het
Tbc1d16 G A 11: 119,156,059 S454L probably benign Het
Tet1 T C 10: 62,839,777 H840R probably benign Het
Usp47 C T 7: 112,059,002 T176M probably damaging Het
Utp6 A T 11: 79,949,010 I284N probably benign Het
Vcpip1 T C 1: 9,747,147 H337R probably benign Het
Wdr78 T A 4: 103,049,561 D685V probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Atg7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02969:Atg7 APN 6 114724923 missense possibly damaging 0.71
R1460:Atg7 UTSW 6 114703364 missense probably damaging 0.99
R1467:Atg7 UTSW 6 114858982 splice site probably benign
R1561:Atg7 UTSW 6 114701172 missense possibly damaging 0.52
R1755:Atg7 UTSW 6 114673677 missense possibly damaging 0.64
R1934:Atg7 UTSW 6 114701235 missense probably damaging 0.98
R1962:Atg7 UTSW 6 114706230 missense probably damaging 1.00
R1964:Atg7 UTSW 6 114706230 missense probably damaging 1.00
R2064:Atg7 UTSW 6 114703363 missense probably damaging 1.00
R3722:Atg7 UTSW 6 114695663 missense probably damaging 0.99
R3870:Atg7 UTSW 6 114697047 missense possibly damaging 0.71
R3926:Atg7 UTSW 6 114673678 missense possibly damaging 0.81
R4044:Atg7 UTSW 6 114701978 missense probably benign 0.00
R4111:Atg7 UTSW 6 114713294 missense probably damaging 0.98
R4212:Atg7 UTSW 6 114703425 missense probably benign 0.02
R4943:Atg7 UTSW 6 114697084 missense probably benign 0.25
R5216:Atg7 UTSW 6 114724949 missense probably damaging 0.96
R5555:Atg7 UTSW 6 114702053 missense probably damaging 1.00
R5618:Atg7 UTSW 6 114673699 missense probably damaging 0.99
R5902:Atg7 UTSW 6 114673678 missense possibly damaging 0.81
R5903:Atg7 UTSW 6 114706293 nonsense probably null
R5980:Atg7 UTSW 6 114680236 missense possibly damaging 0.80
R6031:Atg7 UTSW 6 114671233 missense probably benign 0.01
R6031:Atg7 UTSW 6 114671233 missense probably benign 0.01
R6178:Atg7 UTSW 6 114724895 missense probably damaging 1.00
R6702:Atg7 UTSW 6 114671097 splice site probably null
R6924:Atg7 UTSW 6 114709211 critical splice donor site probably null
R6941:Atg7 UTSW 6 114673678 missense possibly damaging 0.81
R7201:Atg7 UTSW 6 114777057 missense probably damaging 1.00
R7561:Atg7 UTSW 6 114673041 missense possibly damaging 0.80
R8070:Atg7 UTSW 6 114697080 missense probably benign 0.03
R8170:Atg7 UTSW 6 114701190 missense probably benign 0.11
R8329:Atg7 UTSW 6 114686096 missense possibly damaging 0.70
R8367:Atg7 UTSW 6 114686099 missense probably benign
Z1088:Atg7 UTSW 6 114695686 missense probably benign 0.15
Z1176:Atg7 UTSW 6 114673050 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TAATGCATTTAGACACGCCTCC -3'
(R):5'- TGTACTAACAGCGAGAAAATGC -3'

Sequencing Primer
(F):5'- AGACACGCCTCCTCCTTC -3'
(R):5'- GTTGCTGTATAAGAGGCATACAAAAC -3'
Posted On2016-10-06