Incidental Mutation 'R5465:Gpr162'
ID433204
Institutional Source Beutler Lab
Gene Symbol Gpr162
Ensembl Gene ENSMUSG00000038390
Gene NameG protein-coupled receptor 162
SynonymsA-2, Grca
MMRRC Submission 043026-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R5465 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location124858444-124863983 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 124861171 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 172 (V172D)
Ref Sequence ENSEMBL: ENSMUSP00000145267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023958] [ENSMUST00000024044] [ENSMUST00000046893] [ENSMUST00000135127] [ENSMUST00000204667]
Predicted Effect probably benign
Transcript: ENSMUST00000023958
SMART Domains Protein: ENSMUSP00000023958
Gene: ENSMUSG00000023191

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 58 76 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 256 277 N/A INTRINSIC
P4Hc 460 670 8.51e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000024044
SMART Domains Protein: ENSMUSP00000024044
Gene: ENSMUSG00000023274

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
IGv 37 114 7.02e-8 SMART
IG 131 206 3.63e-1 SMART
IG 212 317 3.36e0 SMART
transmembrane domain 394 416 N/A INTRINSIC
Pfam:Tcell_CD4_C 425 452 2.2e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000046893
AA Change: V172D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000038536
Gene: ENSMUSG00000038390
AA Change: V172D

DomainStartEndE-ValueType
Pfam:7tm_1 30 337 1.1e-19 PFAM
low complexity region 348 362 N/A INTRINSIC
low complexity region 462 477 N/A INTRINSIC
low complexity region 482 504 N/A INTRINSIC
low complexity region 513 540 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135127
SMART Domains Protein: ENSMUSP00000116338
Gene: ENSMUSG00000023191

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 58 76 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 256 277 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204253
Predicted Effect probably damaging
Transcript: ENSMUST00000204667
AA Change: V172D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000145267
Gene: ENSMUSG00000038390
AA Change: V172D

DomainStartEndE-ValueType
Pfam:7tm_1 30 337 1.1e-19 PFAM
low complexity region 348 362 N/A INTRINSIC
low complexity region 462 477 N/A INTRINSIC
low complexity region 482 504 N/A INTRINSIC
low complexity region 513 540 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified upon genomic analysis of a gene-dense region at human chromosome 12p13. It appears to be mainly expressed in the brain; however, its function is not known. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aplp1 T C 7: 30,436,852 D500G probably benign Het
Atg7 G A 6: 114,652,532 G4R probably benign Het
Atp11b G A 3: 35,810,184 V302I probably benign Het
Cacna1b C T 2: 24,650,426 probably null Het
Ccna1 T C 3: 55,045,644 H234R probably benign Het
Cplx2 G A 13: 54,379,539 E79K possibly damaging Het
Gnb2 A G 5: 137,528,513 I380T probably damaging Het
Gtf2a1 A C 12: 91,567,791 F191V possibly damaging Het
Ift172 A T 5: 31,261,518 probably null Het
Khdrbs2 T C 1: 32,619,174 Y272H probably damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Map1a T C 2: 121,306,025 S2203P probably damaging Het
Map3k1 A T 13: 111,756,120 L867Q probably benign Het
Ncapd2 A T 6: 125,176,783 F656L probably damaging Het
Olfr1356 T C 10: 78,847,018 K299R probably benign Het
Olfr1463 T C 19: 13,234,688 I146T probably benign Het
Olfr561 A G 7: 102,775,433 K303R probably benign Het
Pcdhb6 A T 18: 37,334,730 I235F probably damaging Het
Pzp A G 6: 128,486,961 S1395P probably damaging Het
Ralgapb C A 2: 158,448,405 T412N possibly damaging Het
Rtn4r A T 16: 18,151,427 M240L probably benign Het
Slit2 C T 5: 48,249,912 T895I probably damaging Het
Slx4ip T G 2: 137,004,947 L44R probably damaging Het
Sptbn2 C A 19: 4,750,105 Q2196K probably benign Het
Tbc1d16 G A 11: 119,156,059 S454L probably benign Het
Tet1 T C 10: 62,839,777 H840R probably benign Het
Usp47 C T 7: 112,059,002 T176M probably damaging Het
Utp6 A T 11: 79,949,010 I284N probably benign Het
Vcpip1 T C 1: 9,747,147 H337R probably benign Het
Wdr78 T A 4: 103,049,561 D685V probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Gpr162
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01134:Gpr162 APN 6 124858857 splice site probably null
IGL01879:Gpr162 APN 6 124861241 missense probably damaging 1.00
IGL01901:Gpr162 APN 6 124861407 missense possibly damaging 0.95
IGL01930:Gpr162 APN 6 124861612 missense possibly damaging 0.82
IGL02334:Gpr162 APN 6 124861160 missense probably damaging 1.00
R1036:Gpr162 UTSW 6 124860860 missense probably damaging 0.99
R1322:Gpr162 UTSW 6 124858901 missense probably damaging 0.96
R1351:Gpr162 UTSW 6 124861198 missense probably damaging 1.00
R1549:Gpr162 UTSW 6 124860088 missense probably damaging 1.00
R1933:Gpr162 UTSW 6 124861447 missense probably damaging 0.98
R4214:Gpr162 UTSW 6 124860068 missense probably damaging 1.00
R4367:Gpr162 UTSW 6 124861695 start gained probably benign
R4628:Gpr162 UTSW 6 124861442 missense probably benign 0.03
R5290:Gpr162 UTSW 6 124861269 missense probably benign 0.17
R5354:Gpr162 UTSW 6 124859637 missense probably benign 0.06
R5404:Gpr162 UTSW 6 124861643 missense possibly damaging 0.73
R5520:Gpr162 UTSW 6 124860913 missense probably damaging 1.00
R5566:Gpr162 UTSW 6 124860938 nonsense probably null
R6184:Gpr162 UTSW 6 124861241 missense probably damaging 1.00
R6450:Gpr162 UTSW 6 124861189 missense possibly damaging 0.84
R6685:Gpr162 UTSW 6 124861531 missense probably damaging 1.00
R6807:Gpr162 UTSW 6 124861201 missense probably damaging 0.97
R6972:Gpr162 UTSW 6 124861309 missense probably damaging 0.99
R6982:Gpr162 UTSW 6 124860956 missense probably damaging 1.00
R7543:Gpr162 UTSW 6 124861392 nonsense probably null
R7650:Gpr162 UTSW 6 124861843 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CAATGGCTGGCACCTCAAAAG -3'
(R):5'- TCTCCTACCATCGCATGTGG -3'

Sequencing Primer
(F):5'- TCAAAAGCTGGCCGGGTAC -3'
(R):5'- CTACCATCGCATGTGGATGGTG -3'
Posted On2016-10-06