Incidental Mutation 'R5465:Ncapd2'
ID433205
Institutional Source Beutler Lab
Gene Symbol Ncapd2
Ensembl Gene ENSMUSG00000038252
Gene Namenon-SMC condensin I complex, subunit D2
Synonyms2810406C15Rik, 2810465G24Rik, CNAP1, CAP-D2
MMRRC Submission 043026-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R5465 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location125168007-125191701 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 125176783 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 656 (F656L)
Ref Sequence ENSEMBL: ENSMUSP00000042260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043848]
Predicted Effect probably damaging
Transcript: ENSMUST00000043848
AA Change: F656L

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000042260
Gene: ENSMUSG00000038252
AA Change: F656L

DomainStartEndE-ValueType
Pfam:Cnd1_N 75 240 1.4e-41 PFAM
low complexity region 461 472 N/A INTRINSIC
low complexity region 936 949 N/A INTRINSIC
Pfam:Cnd1 1058 1224 2.5e-65 PFAM
low complexity region 1329 1345 N/A INTRINSIC
low complexity region 1357 1369 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186561
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186667
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188306
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189706
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191080
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aplp1 T C 7: 30,436,852 D500G probably benign Het
Atg7 G A 6: 114,652,532 G4R probably benign Het
Atp11b G A 3: 35,810,184 V302I probably benign Het
Cacna1b C T 2: 24,650,426 probably null Het
Ccna1 T C 3: 55,045,644 H234R probably benign Het
Cplx2 G A 13: 54,379,539 E79K possibly damaging Het
Gnb2 A G 5: 137,528,513 I380T probably damaging Het
Gpr162 A T 6: 124,861,171 V172D probably damaging Het
Gtf2a1 A C 12: 91,567,791 F191V possibly damaging Het
Ift172 A T 5: 31,261,518 probably null Het
Khdrbs2 T C 1: 32,619,174 Y272H probably damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Map1a T C 2: 121,306,025 S2203P probably damaging Het
Map3k1 A T 13: 111,756,120 L867Q probably benign Het
Olfr1356 T C 10: 78,847,018 K299R probably benign Het
Olfr1463 T C 19: 13,234,688 I146T probably benign Het
Olfr561 A G 7: 102,775,433 K303R probably benign Het
Pcdhb6 A T 18: 37,334,730 I235F probably damaging Het
Pzp A G 6: 128,486,961 S1395P probably damaging Het
Ralgapb C A 2: 158,448,405 T412N possibly damaging Het
Rtn4r A T 16: 18,151,427 M240L probably benign Het
Slit2 C T 5: 48,249,912 T895I probably damaging Het
Slx4ip T G 2: 137,004,947 L44R probably damaging Het
Sptbn2 C A 19: 4,750,105 Q2196K probably benign Het
Tbc1d16 G A 11: 119,156,059 S454L probably benign Het
Tet1 T C 10: 62,839,777 H840R probably benign Het
Usp47 C T 7: 112,059,002 T176M probably damaging Het
Utp6 A T 11: 79,949,010 I284N probably benign Het
Vcpip1 T C 1: 9,747,147 H337R probably benign Het
Wdr78 T A 4: 103,049,561 D685V probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Ncapd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Ncapd2 APN 6 125173425 missense probably benign 0.05
IGL00960:Ncapd2 APN 6 125173848 missense probably benign
IGL01307:Ncapd2 APN 6 125168619 missense possibly damaging 0.56
IGL01612:Ncapd2 APN 6 125177872 missense probably benign 0.01
IGL01903:Ncapd2 APN 6 125177460 missense probably benign
IGL01987:Ncapd2 APN 6 125185841 splice site probably benign
IGL01998:Ncapd2 APN 6 125173115 missense probably benign 0.18
IGL01998:Ncapd2 APN 6 125169933 missense probably damaging 1.00
IGL02329:Ncapd2 APN 6 125189818 missense probably damaging 0.99
IGL02550:Ncapd2 APN 6 125177447 missense probably benign
IGL02662:Ncapd2 APN 6 125176731 missense probably damaging 1.00
IGL02817:Ncapd2 APN 6 125170914 critical splice donor site probably null
IGL03121:Ncapd2 APN 6 125173612 missense probably benign 0.00
IGL03206:Ncapd2 APN 6 125171697 missense possibly damaging 0.85
FR4548:Ncapd2 UTSW 6 125173596 critical splice donor site probably benign
PIT4305001:Ncapd2 UTSW 6 125184027 nonsense probably null
R0486:Ncapd2 UTSW 6 125184027 nonsense probably null
R0635:Ncapd2 UTSW 6 125173036 missense probably benign 0.00
R0699:Ncapd2 UTSW 6 125169880 missense probably benign
R0746:Ncapd2 UTSW 6 125174264 missense possibly damaging 0.50
R0893:Ncapd2 UTSW 6 125173482 missense probably benign
R1385:Ncapd2 UTSW 6 125173115 missense probably benign 0.18
R1513:Ncapd2 UTSW 6 125170992 missense probably damaging 1.00
R1601:Ncapd2 UTSW 6 125185772 missense probably damaging 1.00
R1698:Ncapd2 UTSW 6 125168590 missense probably null 0.39
R2030:Ncapd2 UTSW 6 125176715 missense possibly damaging 0.95
R2035:Ncapd2 UTSW 6 125184528 missense probably benign 0.17
R2359:Ncapd2 UTSW 6 125179416 unclassified probably benign
R3951:Ncapd2 UTSW 6 125186784 missense probably damaging 0.98
R3952:Ncapd2 UTSW 6 125186784 missense probably damaging 0.98
R3953:Ncapd2 UTSW 6 125170734 missense probably damaging 0.96
R4623:Ncapd2 UTSW 6 125173609 missense probably benign 0.04
R4630:Ncapd2 UTSW 6 125179233 splice site probably null
R4667:Ncapd2 UTSW 6 125184518 missense possibly damaging 0.69
R4769:Ncapd2 UTSW 6 125185745 missense probably damaging 1.00
R4936:Ncapd2 UTSW 6 125169840 missense probably benign 0.18
R5130:Ncapd2 UTSW 6 125169924 missense possibly damaging 0.90
R5806:Ncapd2 UTSW 6 125181154 missense probably damaging 0.98
R5823:Ncapd2 UTSW 6 125168700 missense probably benign 0.00
R5888:Ncapd2 UTSW 6 125187089 missense probably damaging 1.00
R5940:Ncapd2 UTSW 6 125168869 missense probably benign
R6198:Ncapd2 UTSW 6 125179323 nonsense probably null
R6406:Ncapd2 UTSW 6 125173878 missense probably benign
R6652:Ncapd2 UTSW 6 125186270 missense probably benign 0.13
R6959:Ncapd2 UTSW 6 125168920 missense probably benign
R6977:Ncapd2 UTSW 6 125171509 missense probably damaging 1.00
R6982:Ncapd2 UTSW 6 125176736 missense probably damaging 0.96
R7143:Ncapd2 UTSW 6 125179561 missense probably benign
R7144:Ncapd2 UTSW 6 125176670 missense probably benign 0.11
R7186:Ncapd2 UTSW 6 125186156 missense possibly damaging 0.89
R7203:Ncapd2 UTSW 6 125184328 missense possibly damaging 0.58
R7384:Ncapd2 UTSW 6 125173401 missense probably benign
R8039:Ncapd2 UTSW 6 125181026 missense probably damaging 0.98
R8047:Ncapd2 UTSW 6 125189799 missense probably damaging 0.98
R8048:Ncapd2 UTSW 6 125179698 nonsense probably null
R8056:Ncapd2 UTSW 6 125171043 missense probably damaging 1.00
R8097:Ncapd2 UTSW 6 125168982 missense possibly damaging 0.78
RF045:Ncapd2 UTSW 6 125179236 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCCTGTGAGAAGCTGACCTTAG -3'
(R):5'- AGGCATTCTAGCGTCGTTCTC -3'

Sequencing Primer
(F):5'- CTGATCTACAAAGTGAGCTCCAGG -3'
(R):5'- ATTCTAGCGTCGTTCTCAGGGAC -3'
Posted On2016-10-06