Incidental Mutation 'R5465:Aplp1'
ID433207
Institutional Source Beutler Lab
Gene Symbol Aplp1
Ensembl Gene ENSMUSG00000006651
Gene Nameamyloid beta (A4) precursor-like protein 1
Synonyms
MMRRC Submission 043026-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5465 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location30434982-30445535 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30436852 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 500 (D500G)
Ref Sequence ENSEMBL: ENSMUSP00000006828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006828]
Predicted Effect probably benign
Transcript: ENSMUST00000006828
AA Change: D500G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000006828
Gene: ENSMUSG00000006651
AA Change: D500G

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
A4_EXTRA 46 211 1.72e-114 SMART
low complexity region 234 247 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
Pfam:APP_E2 289 471 9.3e-72 PFAM
Pfam:APP_amyloid 600 651 9.4e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208792
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the highly conserved amyloid precursor protein gene family. The encoded protein is a membrane-associated glycoprotein that is cleaved by secretases in a manner similar to amyloid beta A4 precursor protein cleavage. This cleavage liberates an intracellular cytoplasmic fragment that may act as a transcriptional activator. The encoded protein may also play a role in synaptic maturation during cortical development. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Animals homozygous for a mutation in this gene show a 10% decrease in body weight at 9 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg7 G A 6: 114,652,532 G4R probably benign Het
Atp11b G A 3: 35,810,184 V302I probably benign Het
Cacna1b C T 2: 24,650,426 probably null Het
Ccna1 T C 3: 55,045,644 H234R probably benign Het
Cplx2 G A 13: 54,379,539 E79K possibly damaging Het
Gnb2 A G 5: 137,528,513 I380T probably damaging Het
Gpr162 A T 6: 124,861,171 V172D probably damaging Het
Gtf2a1 A C 12: 91,567,791 F191V possibly damaging Het
Ift172 A T 5: 31,261,518 probably null Het
Khdrbs2 T C 1: 32,619,174 Y272H probably damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Map1a T C 2: 121,306,025 S2203P probably damaging Het
Map3k1 A T 13: 111,756,120 L867Q probably benign Het
Ncapd2 A T 6: 125,176,783 F656L probably damaging Het
Olfr1356 T C 10: 78,847,018 K299R probably benign Het
Olfr1463 T C 19: 13,234,688 I146T probably benign Het
Olfr561 A G 7: 102,775,433 K303R probably benign Het
Pcdhb6 A T 18: 37,334,730 I235F probably damaging Het
Pzp A G 6: 128,486,961 S1395P probably damaging Het
Ralgapb C A 2: 158,448,405 T412N possibly damaging Het
Rtn4r A T 16: 18,151,427 M240L probably benign Het
Slit2 C T 5: 48,249,912 T895I probably damaging Het
Slx4ip T G 2: 137,004,947 L44R probably damaging Het
Sptbn2 C A 19: 4,750,105 Q2196K probably benign Het
Tbc1d16 G A 11: 119,156,059 S454L probably benign Het
Tet1 T C 10: 62,839,777 H840R probably benign Het
Usp47 C T 7: 112,059,002 T176M probably damaging Het
Utp6 A T 11: 79,949,010 I284N probably benign Het
Vcpip1 T C 1: 9,747,147 H337R probably benign Het
Wdr78 T A 4: 103,049,561 D685V probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Aplp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Aplp1 APN 7 30444418 missense probably damaging 0.97
R0021:Aplp1 UTSW 7 30435816 splice site probably benign
R0021:Aplp1 UTSW 7 30435816 splice site probably benign
R0034:Aplp1 UTSW 7 30444442 missense probably damaging 1.00
R1480:Aplp1 UTSW 7 30436023 missense probably benign 0.01
R1538:Aplp1 UTSW 7 30436027 missense probably benign
R2177:Aplp1 UTSW 7 30442521 nonsense probably null
R3017:Aplp1 UTSW 7 30435971 critical splice donor site probably null
R5143:Aplp1 UTSW 7 30441123 missense probably damaging 1.00
R5482:Aplp1 UTSW 7 30440175 missense probably damaging 1.00
R5530:Aplp1 UTSW 7 30436829 missense possibly damaging 0.70
R6112:Aplp1 UTSW 7 30435477 missense probably damaging 1.00
R6721:Aplp1 UTSW 7 30440295 missense probably null 1.00
R6931:Aplp1 UTSW 7 30443200 missense probably damaging 1.00
R7314:Aplp1 UTSW 7 30435989 missense probably damaging 0.98
R7707:Aplp1 UTSW 7 30443098 missense probably damaging 1.00
R7980:Aplp1 UTSW 7 30435567 missense probably benign 0.44
R8005:Aplp1 UTSW 7 30436045 critical splice acceptor site probably null
R8126:Aplp1 UTSW 7 30441739 missense probably damaging 1.00
Z1177:Aplp1 UTSW 7 30438189 missense probably benign 0.44
Z1177:Aplp1 UTSW 7 30438279 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TAGCATGCACAAAGCCCTG -3'
(R):5'- AATCAGTCCCTGCCTAGCTC -3'

Sequencing Primer
(F):5'- TGGGCTCCCAACAGCTTC -3'
(R):5'- TAGCTCCTACTGCAGGTCCAG -3'
Posted On2016-10-06