Incidental Mutation 'R5465:Utp6'
ID433215
Institutional Source Beutler Lab
Gene Symbol Utp6
Ensembl Gene ENSMUSG00000035575
Gene NameUTP6 small subunit processome component
SynonymsHCA66, 4732497O03Rik
MMRRC Submission 043026-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R5465 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location79932321-79962390 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79949010 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 284 (I284N)
Ref Sequence ENSEMBL: ENSMUSP00000103876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043152] [ENSMUST00000108241]
Predicted Effect probably benign
Transcript: ENSMUST00000043152
AA Change: I284N

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000046643
Gene: ENSMUSG00000035575
AA Change: I284N

DomainStartEndE-ValueType
Blast:HAT 25 63 5e-11 BLAST
HAT 87 119 6.33e2 SMART
HAT 121 153 5.54e-1 SMART
HAT 156 188 2.41e-1 SMART
HAT 305 336 4.13e0 SMART
Blast:HAT 350 382 1e-11 BLAST
Blast:HAT 418 451 2e-9 BLAST
Blast:HAT 454 487 3e-12 BLAST
HAT 489 521 8.05e0 SMART
HAT 525 558 9.13e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108241
AA Change: I284N

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000103876
Gene: ENSMUSG00000035575
AA Change: I284N

DomainStartEndE-ValueType
Blast:HAT 25 63 5e-11 BLAST
HAT 87 119 6.33e2 SMART
HAT 121 153 5.54e-1 SMART
HAT 156 188 2.41e-1 SMART
HAT 305 336 4.13e0 SMART
Blast:HAT 350 382 1e-11 BLAST
Blast:HAT 418 451 2e-9 BLAST
Blast:HAT 454 487 3e-12 BLAST
HAT 489 521 8.05e0 SMART
HAT 525 558 9.13e-2 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aplp1 T C 7: 30,436,852 D500G probably benign Het
Atg7 G A 6: 114,652,532 G4R probably benign Het
Atp11b G A 3: 35,810,184 V302I probably benign Het
Cacna1b C T 2: 24,650,426 probably null Het
Ccna1 T C 3: 55,045,644 H234R probably benign Het
Cplx2 G A 13: 54,379,539 E79K possibly damaging Het
Gnb2 A G 5: 137,528,513 I380T probably damaging Het
Gpr162 A T 6: 124,861,171 V172D probably damaging Het
Gtf2a1 A C 12: 91,567,791 F191V possibly damaging Het
Ift172 A T 5: 31,261,518 probably null Het
Khdrbs2 T C 1: 32,619,174 Y272H probably damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Map1a T C 2: 121,306,025 S2203P probably damaging Het
Map3k1 A T 13: 111,756,120 L867Q probably benign Het
Ncapd2 A T 6: 125,176,783 F656L probably damaging Het
Olfr1356 T C 10: 78,847,018 K299R probably benign Het
Olfr1463 T C 19: 13,234,688 I146T probably benign Het
Olfr561 A G 7: 102,775,433 K303R probably benign Het
Pcdhb6 A T 18: 37,334,730 I235F probably damaging Het
Pzp A G 6: 128,486,961 S1395P probably damaging Het
Ralgapb C A 2: 158,448,405 T412N possibly damaging Het
Rtn4r A T 16: 18,151,427 M240L probably benign Het
Slit2 C T 5: 48,249,912 T895I probably damaging Het
Slx4ip T G 2: 137,004,947 L44R probably damaging Het
Sptbn2 C A 19: 4,750,105 Q2196K probably benign Het
Tbc1d16 G A 11: 119,156,059 S454L probably benign Het
Tet1 T C 10: 62,839,777 H840R probably benign Het
Usp47 C T 7: 112,059,002 T176M probably damaging Het
Vcpip1 T C 1: 9,747,147 H337R probably benign Het
Wdr78 T A 4: 103,049,561 D685V probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Utp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Utp6 APN 11 79955705 nonsense probably null
IGL02889:Utp6 APN 11 79949070 missense possibly damaging 0.88
IGL03028:Utp6 APN 11 79953624 missense probably damaging 0.99
IGL03040:Utp6 APN 11 79936113 splice site probably benign
IGL03084:Utp6 APN 11 79962216 critical splice donor site probably null
IGL03236:Utp6 APN 11 79960741 splice site probably benign
PIT4382001:Utp6 UTSW 11 79962273 missense probably benign 0.02
R0082:Utp6 UTSW 11 79953631 missense possibly damaging 0.80
R0140:Utp6 UTSW 11 79956725 splice site probably benign
R0962:Utp6 UTSW 11 79941868 splice site probably benign
R1485:Utp6 UTSW 11 79948923 missense probably damaging 1.00
R2376:Utp6 UTSW 11 79955613 missense probably damaging 0.99
R2380:Utp6 UTSW 11 79936005 missense possibly damaging 0.67
R4065:Utp6 UTSW 11 79946247 missense probably damaging 1.00
R5774:Utp6 UTSW 11 79953598 missense probably benign
R6842:Utp6 UTSW 11 79940949 missense probably benign 0.00
R7507:Utp6 UTSW 11 79942186 missense possibly damaging 0.53
R7793:Utp6 UTSW 11 79937730 missense probably benign 0.00
R8349:Utp6 UTSW 11 79945784 missense probably benign 0.00
R8449:Utp6 UTSW 11 79945784 missense probably benign 0.00
Z1176:Utp6 UTSW 11 79935962 missense probably damaging 1.00
Z1177:Utp6 UTSW 11 79941909 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCTCTACTAGGGGCTGAACTC -3'
(R):5'- ATGCCACAGTGCAGAACAG -3'

Sequencing Primer
(F):5'- TCAGGGCACAGTCACAGTCAG -3'
(R):5'- CTCTTGTGTTACTGCAGCTGTAAAAG -3'
Posted On2016-10-06