Incidental Mutation 'R5465:Tbc1d16'
ID433216
Institutional Source Beutler Lab
Gene Symbol Tbc1d16
Ensembl Gene ENSMUSG00000039976
Gene NameTBC1 domain family, member 16
Synonyms
MMRRC Submission 043026-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5465 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location119143045-119228499 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 119156059 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 454 (S454L)
Ref Sequence ENSEMBL: ENSMUSP00000147182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036113] [ENSMUST00000207655]
Predicted Effect probably benign
Transcript: ENSMUST00000036113
AA Change: S455L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048516
Gene: ENSMUSG00000039976
AA Change: S455L

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
Blast:TBC 63 362 5e-75 BLAST
Blast:TBC 373 418 2e-13 BLAST
TBC 421 659 4.39e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183965
Predicted Effect probably benign
Transcript: ENSMUST00000207655
AA Change: S454L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aplp1 T C 7: 30,436,852 D500G probably benign Het
Atg7 G A 6: 114,652,532 G4R probably benign Het
Atp11b G A 3: 35,810,184 V302I probably benign Het
Cacna1b C T 2: 24,650,426 probably null Het
Ccna1 T C 3: 55,045,644 H234R probably benign Het
Cplx2 G A 13: 54,379,539 E79K possibly damaging Het
Gnb2 A G 5: 137,528,513 I380T probably damaging Het
Gpr162 A T 6: 124,861,171 V172D probably damaging Het
Gtf2a1 A C 12: 91,567,791 F191V possibly damaging Het
Ift172 A T 5: 31,261,518 probably null Het
Khdrbs2 T C 1: 32,619,174 Y272H probably damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Map1a T C 2: 121,306,025 S2203P probably damaging Het
Map3k1 A T 13: 111,756,120 L867Q probably benign Het
Ncapd2 A T 6: 125,176,783 F656L probably damaging Het
Olfr1356 T C 10: 78,847,018 K299R probably benign Het
Olfr1463 T C 19: 13,234,688 I146T probably benign Het
Olfr561 A G 7: 102,775,433 K303R probably benign Het
Pcdhb6 A T 18: 37,334,730 I235F probably damaging Het
Pzp A G 6: 128,486,961 S1395P probably damaging Het
Ralgapb C A 2: 158,448,405 T412N possibly damaging Het
Rtn4r A T 16: 18,151,427 M240L probably benign Het
Slit2 C T 5: 48,249,912 T895I probably damaging Het
Slx4ip T G 2: 137,004,947 L44R probably damaging Het
Sptbn2 C A 19: 4,750,105 Q2196K probably benign Het
Tet1 T C 10: 62,839,777 H840R probably benign Het
Usp47 C T 7: 112,059,002 T176M probably damaging Het
Utp6 A T 11: 79,949,010 I284N probably benign Het
Vcpip1 T C 1: 9,747,147 H337R probably benign Het
Wdr78 T A 4: 103,049,561 D685V probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Tbc1d16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01930:Tbc1d16 APN 11 119156075 missense possibly damaging 0.69
IGL01973:Tbc1d16 APN 11 119156707 missense probably benign 0.19
IGL02456:Tbc1d16 APN 11 119210546 missense probably damaging 1.00
H8441:Tbc1d16 UTSW 11 119149014 nonsense probably null
R0118:Tbc1d16 UTSW 11 119157816 missense probably damaging 1.00
R0255:Tbc1d16 UTSW 11 119147575 missense possibly damaging 0.94
R0330:Tbc1d16 UTSW 11 119158729 critical splice donor site probably null
R0620:Tbc1d16 UTSW 11 119209038 missense probably benign 0.04
R1502:Tbc1d16 UTSW 11 119154004 missense probably damaging 1.00
R1806:Tbc1d16 UTSW 11 119156101 missense probably damaging 1.00
R2163:Tbc1d16 UTSW 11 119155078 splice site probably benign
R2897:Tbc1d16 UTSW 11 119157828 missense probably damaging 0.97
R2898:Tbc1d16 UTSW 11 119157828 missense probably damaging 0.97
R4454:Tbc1d16 UTSW 11 119157873 missense possibly damaging 0.86
R5193:Tbc1d16 UTSW 11 119158820 missense probably benign 0.00
R5478:Tbc1d16 UTSW 11 119155091 missense probably benign 0.07
R5642:Tbc1d16 UTSW 11 119158791 missense probably damaging 0.98
R5721:Tbc1d16 UTSW 11 119158730 critical splice donor site probably null
R6195:Tbc1d16 UTSW 11 119210565 nonsense probably null
R6233:Tbc1d16 UTSW 11 119210565 nonsense probably null
R6596:Tbc1d16 UTSW 11 119157775 missense probably damaging 1.00
R6932:Tbc1d16 UTSW 11 119208916 missense probably damaging 1.00
R7023:Tbc1d16 UTSW 11 119158791 missense probably damaging 0.98
R7262:Tbc1d16 UTSW 11 119155095 missense probably benign 0.00
R8006:Tbc1d16 UTSW 11 119156072 missense probably damaging 0.96
R8506:Tbc1d16 UTSW 11 119148958 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTTATCCTGCCAATGGTGTTG -3'
(R):5'- AATTGCCGGGGTCTGAATCG -3'

Sequencing Primer
(F):5'- GGCTCTTGGGAGACTCACG -3'
(R):5'- TCTGAATCGAGGCTCGCCAAAG -3'
Posted On2016-10-06