Incidental Mutation 'R5465:Gtf2a1'
ID433217
Institutional Source Beutler Lab
Gene Symbol Gtf2a1
Ensembl Gene ENSMUSG00000020962
Gene Namegeneral transcription factor II A, 1
SynonymsTfiia1, TfIIAa/b, 19kDa, 37kDa, 6330549H03Rik
MMRRC Submission 043026-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5465 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location91555262-91590487 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 91567791 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 191 (F191V)
Ref Sequence ENSEMBL: ENSMUSP00000068562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021345] [ENSMUST00000063314]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021345
AA Change: F230V

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021345
Gene: ENSMUSG00000020962
AA Change: F230V

DomainStartEndE-ValueType
TFIIA 12 378 5.47e-146 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000063314
AA Change: F191V

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000068562
Gene: ENSMUSG00000020962
AA Change: F191V

DomainStartEndE-ValueType
Pfam:TFIIA 1 339 9.3e-68 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Accurate transcription initiation on TATA-containing class II genes involves the ordered assembly of RNA polymerase II (POLR2A; MIM 180660) and several general initiation factors (summarized by DeJong and Roeder, 1993 [PubMed 8224848]). One of these factors is TFIIA, which when purified from HeLa extracts consists of 35-, 19-, and 12-kD subunits.[supplied by OMIM, Jul 2010]
PHENOTYPE: Mice homozygous for a hypomorphic allele where D/G cleavage residues are replaced with noncleavable A/A show neonatal lethality, feeding defects, low testis weight, and male infertility associated with azoospermia, small seminiferous tubules, lack of elongating spermatids, and increased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aplp1 T C 7: 30,436,852 D500G probably benign Het
Atg7 G A 6: 114,652,532 G4R probably benign Het
Atp11b G A 3: 35,810,184 V302I probably benign Het
Cacna1b C T 2: 24,650,426 probably null Het
Ccna1 T C 3: 55,045,644 H234R probably benign Het
Cplx2 G A 13: 54,379,539 E79K possibly damaging Het
Gnb2 A G 5: 137,528,513 I380T probably damaging Het
Gpr162 A T 6: 124,861,171 V172D probably damaging Het
Ift172 A T 5: 31,261,518 probably null Het
Khdrbs2 T C 1: 32,619,174 Y272H probably damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Map1a T C 2: 121,306,025 S2203P probably damaging Het
Map3k1 A T 13: 111,756,120 L867Q probably benign Het
Ncapd2 A T 6: 125,176,783 F656L probably damaging Het
Olfr1356 T C 10: 78,847,018 K299R probably benign Het
Olfr1463 T C 19: 13,234,688 I146T probably benign Het
Olfr561 A G 7: 102,775,433 K303R probably benign Het
Pcdhb6 A T 18: 37,334,730 I235F probably damaging Het
Pzp A G 6: 128,486,961 S1395P probably damaging Het
Ralgapb C A 2: 158,448,405 T412N possibly damaging Het
Rtn4r A T 16: 18,151,427 M240L probably benign Het
Slit2 C T 5: 48,249,912 T895I probably damaging Het
Slx4ip T G 2: 137,004,947 L44R probably damaging Het
Sptbn2 C A 19: 4,750,105 Q2196K probably benign Het
Tbc1d16 G A 11: 119,156,059 S454L probably benign Het
Tet1 T C 10: 62,839,777 H840R probably benign Het
Usp47 C T 7: 112,059,002 T176M probably damaging Het
Utp6 A T 11: 79,949,010 I284N probably benign Het
Vcpip1 T C 1: 9,747,147 H337R probably benign Het
Wdr78 T A 4: 103,049,561 D685V probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Gtf2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Gtf2a1 APN 12 91567833 missense probably benign 0.00
IGL02561:Gtf2a1 APN 12 91575753 missense possibly damaging 0.93
IGL03035:Gtf2a1 APN 12 91572637 splice site probably benign
PIT4618001:Gtf2a1 UTSW 12 91567769 missense probably benign 0.09
R0436:Gtf2a1 UTSW 12 91568273 splice site probably null
R1595:Gtf2a1 UTSW 12 91589549 missense probably damaging 0.98
R2240:Gtf2a1 UTSW 12 91586739 missense possibly damaging 0.87
R4020:Gtf2a1 UTSW 12 91572577 missense possibly damaging 0.92
R4043:Gtf2a1 UTSW 12 91575667 missense probably benign 0.00
R4044:Gtf2a1 UTSW 12 91575667 missense probably benign 0.00
R4095:Gtf2a1 UTSW 12 91575637 missense possibly damaging 0.68
R4584:Gtf2a1 UTSW 12 91562926 missense possibly damaging 0.66
R4585:Gtf2a1 UTSW 12 91562926 missense possibly damaging 0.66
R4952:Gtf2a1 UTSW 12 91575749 missense possibly damaging 0.70
R5566:Gtf2a1 UTSW 12 91567594 missense possibly damaging 0.63
R7055:Gtf2a1 UTSW 12 91586749 missense possibly damaging 0.93
R7220:Gtf2a1 UTSW 12 91567724 missense probably benign 0.00
R7282:Gtf2a1 UTSW 12 91567835 missense possibly damaging 0.56
R7459:Gtf2a1 UTSW 12 91575652 missense probably benign 0.00
R7484:Gtf2a1 UTSW 12 91562973 missense probably benign 0.01
X0063:Gtf2a1 UTSW 12 91572612 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ATAGAAACTTACTTCTTCCACCTGC -3'
(R):5'- GTGCAGCAGTCAGAAACAATTG -3'

Sequencing Primer
(F):5'- CACCTGCCCATCTTCAGC -3'
(R):5'- TGCAGCAGTCAGAAACAATTGTACTG -3'
Posted On2016-10-06