Incidental Mutation 'R5465:Cplx2'
ID433218
Institutional Source Beutler Lab
Gene Symbol Cplx2
Ensembl Gene ENSMUSG00000025867
Gene Namecomplexin 2
Synonyms921-L
MMRRC Submission 043026-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R5465 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location54371349-54383917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 54379539 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 79 (E79K)
Ref Sequence ENSEMBL: ENSMUSP00000026985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026985]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026985
AA Change: E79K

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000026985
Gene: ENSMUSG00000025867
AA Change: E79K

DomainStartEndE-ValueType
Pfam:Synaphin 1 133 3.1e-45 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins encoded by the complexin/synaphin gene family are cytosolic proteins that function in synaptic vesicle exocytosis. These proteins bind syntaxin, part of the SNAP receptor. The protein product of this gene binds to the SNAP receptor complex and disrupts it, allowing transmitter release. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a variety of neurological abnormalities related to coordination, learning, and social interaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aplp1 T C 7: 30,436,852 D500G probably benign Het
Atg7 G A 6: 114,652,532 G4R probably benign Het
Atp11b G A 3: 35,810,184 V302I probably benign Het
Cacna1b C T 2: 24,650,426 probably null Het
Ccna1 T C 3: 55,045,644 H234R probably benign Het
Gnb2 A G 5: 137,528,513 I380T probably damaging Het
Gpr162 A T 6: 124,861,171 V172D probably damaging Het
Gtf2a1 A C 12: 91,567,791 F191V possibly damaging Het
Ift172 A T 5: 31,261,518 probably null Het
Khdrbs2 T C 1: 32,619,174 Y272H probably damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Map1a T C 2: 121,306,025 S2203P probably damaging Het
Map3k1 A T 13: 111,756,120 L867Q probably benign Het
Ncapd2 A T 6: 125,176,783 F656L probably damaging Het
Olfr1356 T C 10: 78,847,018 K299R probably benign Het
Olfr1463 T C 19: 13,234,688 I146T probably benign Het
Olfr561 A G 7: 102,775,433 K303R probably benign Het
Pcdhb6 A T 18: 37,334,730 I235F probably damaging Het
Pzp A G 6: 128,486,961 S1395P probably damaging Het
Ralgapb C A 2: 158,448,405 T412N possibly damaging Het
Rtn4r A T 16: 18,151,427 M240L probably benign Het
Slit2 C T 5: 48,249,912 T895I probably damaging Het
Slx4ip T G 2: 137,004,947 L44R probably damaging Het
Sptbn2 C A 19: 4,750,105 Q2196K probably benign Het
Tbc1d16 G A 11: 119,156,059 S454L probably benign Het
Tet1 T C 10: 62,839,777 H840R probably benign Het
Usp47 C T 7: 112,059,002 T176M probably damaging Het
Utp6 A T 11: 79,949,010 I284N probably benign Het
Vcpip1 T C 1: 9,747,147 H337R probably benign Het
Wdr78 T A 4: 103,049,561 D685V probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Cplx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1239:Cplx2 UTSW 13 54379602 missense probably damaging 0.99
R4280:Cplx2 UTSW 13 54379564 missense probably damaging 1.00
R4283:Cplx2 UTSW 13 54379564 missense probably damaging 1.00
R4362:Cplx2 UTSW 13 54378817 missense probably benign 0.02
R4363:Cplx2 UTSW 13 54378817 missense probably benign 0.02
R4649:Cplx2 UTSW 13 54379548 missense probably benign 0.14
R4965:Cplx2 UTSW 13 54379647 missense possibly damaging 0.95
R5165:Cplx2 UTSW 13 54378976 missense possibly damaging 0.80
R6193:Cplx2 UTSW 13 54379593 missense probably damaging 1.00
R6642:Cplx2 UTSW 13 54378923 missense probably damaging 0.98
R7361:Cplx2 UTSW 13 54378826 missense probably benign 0.06
R7422:Cplx2 UTSW 13 54378850 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TCAGTCACCTGCTAAAGACTGG -3'
(R):5'- CCCTTTGGAACTGAGACTTAACTG -3'

Sequencing Primer
(F):5'- ACCTGCTAAAGACTGGGCTCAG -3'
(R):5'- AGGAGGATGGGTTACTTCTTGAAC -3'
Posted On2016-10-06