Incidental Mutation 'R5465:Pcdhb6'
ID433222
Institutional Source Beutler Lab
Gene Symbol Pcdhb6
Ensembl Gene ENSMUSG00000051678
Gene Nameprotocadherin beta 6
SynonymsPcdhb5B, PcdhbF
MMRRC Submission 043026-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R5465 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location37333921-37337674 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37334730 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 235 (I235F)
Ref Sequence ENSEMBL: ENSMUSP00000058592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061717] [ENSMUST00000115661] [ENSMUST00000194544] [ENSMUST00000194655]
Predicted Effect probably damaging
Transcript: ENSMUST00000061717
AA Change: I235F

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000058592
Gene: ENSMUSG00000051678
AA Change: I235F

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 2.7e-33 PFAM
CA 155 240 1.48e-22 SMART
CA 264 344 3.02e-28 SMART
CA 367 448 1.69e-22 SMART
CA 472 558 1.65e-25 SMART
CA 588 669 6.24e-12 SMART
Pfam:Cadherin_C_2 685 768 4.7e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194655
SMART Domains Protein: ENSMUSP00000141773
Gene: ENSMUSG00000051678

DomainStartEndE-ValueType
Blast:CA 1 60 2e-11 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aplp1 T C 7: 30,436,852 D500G probably benign Het
Atg7 G A 6: 114,652,532 G4R probably benign Het
Atp11b G A 3: 35,810,184 V302I probably benign Het
Cacna1b C T 2: 24,650,426 probably null Het
Ccna1 T C 3: 55,045,644 H234R probably benign Het
Cplx2 G A 13: 54,379,539 E79K possibly damaging Het
Gnb2 A G 5: 137,528,513 I380T probably damaging Het
Gpr162 A T 6: 124,861,171 V172D probably damaging Het
Gtf2a1 A C 12: 91,567,791 F191V possibly damaging Het
Ift172 A T 5: 31,261,518 probably null Het
Khdrbs2 T C 1: 32,619,174 Y272H probably damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Map1a T C 2: 121,306,025 S2203P probably damaging Het
Map3k1 A T 13: 111,756,120 L867Q probably benign Het
Ncapd2 A T 6: 125,176,783 F656L probably damaging Het
Olfr1356 T C 10: 78,847,018 K299R probably benign Het
Olfr1463 T C 19: 13,234,688 I146T probably benign Het
Olfr561 A G 7: 102,775,433 K303R probably benign Het
Pzp A G 6: 128,486,961 S1395P probably damaging Het
Ralgapb C A 2: 158,448,405 T412N possibly damaging Het
Rtn4r A T 16: 18,151,427 M240L probably benign Het
Slit2 C T 5: 48,249,912 T895I probably damaging Het
Slx4ip T G 2: 137,004,947 L44R probably damaging Het
Sptbn2 C A 19: 4,750,105 Q2196K probably benign Het
Tbc1d16 G A 11: 119,156,059 S454L probably benign Het
Tet1 T C 10: 62,839,777 H840R probably benign Het
Usp47 C T 7: 112,059,002 T176M probably damaging Het
Utp6 A T 11: 79,949,010 I284N probably benign Het
Vcpip1 T C 1: 9,747,147 H337R probably benign Het
Wdr78 T A 4: 103,049,561 D685V probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Pcdhb6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Pcdhb6 APN 18 37334224 missense probably damaging 1.00
IGL02123:Pcdhb6 APN 18 37335820 missense probably damaging 1.00
IGL02491:Pcdhb6 APN 18 37335682 missense probably damaging 1.00
IGL02496:Pcdhb6 APN 18 37335454 missense probably damaging 1.00
IGL02608:Pcdhb6 APN 18 37334694 missense probably damaging 0.99
IGL03130:Pcdhb6 APN 18 37335587 nonsense probably null
IGL03144:Pcdhb6 APN 18 37334406 missense probably damaging 1.00
IGL03189:Pcdhb6 APN 18 37336152 missense probably damaging 0.98
IGL03203:Pcdhb6 APN 18 37334532 missense possibly damaging 0.95
IGL03388:Pcdhb6 APN 18 37336137 missense probably damaging 0.99
PIT4445001:Pcdhb6 UTSW 18 37335247 missense possibly damaging 0.67
R0571:Pcdhb6 UTSW 18 37335114 missense probably benign 0.01
R0734:Pcdhb6 UTSW 18 37335334 missense probably damaging 0.99
R1727:Pcdhb6 UTSW 18 37334587 missense probably damaging 1.00
R2206:Pcdhb6 UTSW 18 37335580 missense probably benign 0.10
R2207:Pcdhb6 UTSW 18 37335580 missense probably benign 0.10
R2303:Pcdhb6 UTSW 18 37336231 missense probably damaging 1.00
R2401:Pcdhb6 UTSW 18 37335169 missense probably benign 0.35
R3409:Pcdhb6 UTSW 18 37335892 missense probably damaging 1.00
R3411:Pcdhb6 UTSW 18 37335892 missense probably damaging 1.00
R3625:Pcdhb6 UTSW 18 37336140 missense probably damaging 1.00
R3716:Pcdhb6 UTSW 18 37336206 missense probably benign 0.01
R4745:Pcdhb6 UTSW 18 37335373 missense possibly damaging 0.86
R4821:Pcdhb6 UTSW 18 37334328 missense probably damaging 1.00
R5218:Pcdhb6 UTSW 18 37334335 missense possibly damaging 0.95
R5522:Pcdhb6 UTSW 18 37334349 missense probably benign
R5556:Pcdhb6 UTSW 18 37334389 missense probably damaging 1.00
R5703:Pcdhb6 UTSW 18 37334700 missense probably benign 0.15
R6154:Pcdhb6 UTSW 18 37334913 missense probably benign 0.00
R6256:Pcdhb6 UTSW 18 37335925 missense probably damaging 0.98
R6304:Pcdhb6 UTSW 18 37335921 nonsense probably null
R6528:Pcdhb6 UTSW 18 37334503 missense probably damaging 1.00
R6883:Pcdhb6 UTSW 18 37335145 missense probably damaging 1.00
R7045:Pcdhb6 UTSW 18 37336276 missense possibly damaging 0.88
R7307:Pcdhb6 UTSW 18 37335478 missense probably benign
R7313:Pcdhb6 UTSW 18 37335208 missense probably damaging 0.99
R7378:Pcdhb6 UTSW 18 37335172 missense probably damaging 1.00
R7555:Pcdhb6 UTSW 18 37335279 missense possibly damaging 0.60
R7606:Pcdhb6 UTSW 18 37335606 missense probably damaging 0.99
R7701:Pcdhb6 UTSW 18 37334509 missense probably damaging 1.00
R7830:Pcdhb6 UTSW 18 37336312 missense probably benign 0.05
R7905:Pcdhb6 UTSW 18 37334554 missense probably benign 0.00
R7982:Pcdhb6 UTSW 18 37334220 nonsense probably null
Z1088:Pcdhb6 UTSW 18 37335146 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGACATTGGAAGCAACGC -3'
(R):5'- TTACAAATGGCTGAGGACCTCC -3'

Sequencing Primer
(F):5'- CATTGGAAGCAACGCTGTTC -3'
(R):5'- CCCCACCTTGAAACAGAGAGTAGG -3'
Posted On2016-10-06