Incidental Mutation 'R5466:Zfp703'
ID433242
Institutional Source Beutler Lab
Gene Symbol Zfp703
Ensembl Gene ENSMUSG00000085795
Gene Namezinc finger protein 703
SynonymsZeppo1, End2, 1110032O19Rik, Csmn1
MMRRC Submission 043027-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.295) question?
Stock #R5466 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location26977325-26981461 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 26979205 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 299 (P299L)
Ref Sequence ENSEMBL: ENSMUSP00000128757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127097] [ENSMUST00000154256] [ENSMUST00000209411] [ENSMUST00000209610]
Predicted Effect probably benign
Transcript: ENSMUST00000127097
SMART Domains Protein: ENSMUSP00000132801
Gene: ENSMUSG00000085795

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000154256
AA Change: P299L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128757
Gene: ENSMUSG00000085795
AA Change: P299L

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
low complexity region 133 145 N/A INTRINSIC
low complexity region 164 191 N/A INTRINSIC
low complexity region 212 231 N/A INTRINSIC
low complexity region 261 275 N/A INTRINSIC
Pfam:nlz1 315 369 3.6e-24 PFAM
low complexity region 426 442 N/A INTRINSIC
ZnF_C2H2 460 488 1.16e1 SMART
low complexity region 497 541 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209411
Predicted Effect probably benign
Transcript: ENSMUST00000209610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210723
Meta Mutation Damage Score 0.5368 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik C A 2: 68,711,389 A17E probably benign Het
Actc1 T C 2: 114,050,498 D82G probably damaging Het
Aox1 G C 1: 58,041,460 E23Q probably damaging Het
Arap3 A G 18: 37,996,736 V124A probably benign Het
Armc5 A G 7: 128,240,164 N218S probably damaging Het
Cacna2d1 T A 5: 16,246,714 V192E probably damaging Het
Col6a5 T A 9: 105,931,083 E922V unknown Het
Dennd4b G A 3: 90,268,500 probably null Het
Dnah12 A G 14: 26,771,050 D1256G probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dpy19l1 T C 9: 24,414,388 E707G probably damaging Het
Farp1 C T 14: 121,235,077 P208L probably damaging Het
Fgf11 T C 11: 69,799,441 I107V probably damaging Het
Fuca2 C T 10: 13,512,697 Q406* probably null Het
Gm10428 A G 11: 62,753,106 probably benign Het
Gm17430 A G 18: 9,726,228 V148A probably benign Het
Gm5930 A T 14: 44,337,557 N57K probably damaging Het
Gucy2c T A 6: 136,781,465 K48* probably null Het
Ip6k2 C T 9: 108,798,462 R109C probably damaging Het
Kif21b T A 1: 136,147,525 F159I probably damaging Het
Macf1 A T 4: 123,452,865 S1981T possibly damaging Het
Mga T A 2: 119,902,697 L9M probably damaging Het
Mov10l1 T C 15: 88,985,701 probably null Het
Msrb1 A T 17: 24,739,559 H39L possibly damaging Het
Olfr1222 A T 2: 89,125,133 F199L probably benign Het
Olfr449 A T 6: 42,838,093 T71S probably benign Het
Pcdha1 G A 18: 36,932,259 A659T possibly damaging Het
Pcm1 T A 8: 41,272,462 probably null Het
Rfpl4b C A 10: 38,821,398 C69F probably damaging Het
Tnn G A 1: 160,120,536 T869I possibly damaging Het
Trp53i11 C A 2: 93,199,383 L121I possibly damaging Het
Uimc1 A G 13: 55,075,848 S204P probably damaging Het
Usp43 A T 11: 67,913,883 N169K probably damaging Het
Vldlr A G 19: 27,239,843 probably null Het
Vmn2r115 A G 17: 23,360,056 I834M probably damaging Het
Zbtb21 A G 16: 97,950,498 S690P possibly damaging Het
Other mutations in Zfp703
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02441:Zfp703 APN 8 26980008 missense probably damaging 0.98
R1524:Zfp703 UTSW 8 26979373 missense probably damaging 1.00
R2082:Zfp703 UTSW 8 26978988 missense probably benign 0.01
R4049:Zfp703 UTSW 8 26979085 missense possibly damaging 0.70
R4570:Zfp703 UTSW 8 26978953 missense probably benign 0.10
R4884:Zfp703 UTSW 8 26978701 missense probably benign 0.03
R4929:Zfp703 UTSW 8 26978851 missense possibly damaging 0.66
R4938:Zfp703 UTSW 8 26979773 missense probably damaging 1.00
R4943:Zfp703 UTSW 8 26979591 missense probably benign 0.35
R5117:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5118:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5297:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5465:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5467:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5492:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5493:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5494:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5757:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5758:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5802:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5828:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5850:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5854:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5856:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5959:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R6464:Zfp703 UTSW 8 26979327 missense probably damaging 1.00
R6867:Zfp703 UTSW 8 26978640 missense probably damaging 0.97
R7067:Zfp703 UTSW 8 26979016 missense probably damaging 0.96
R7812:Zfp703 UTSW 8 26979878 missense probably damaging 1.00
R7880:Zfp703 UTSW 8 26978690 missense unknown
R8167:Zfp703 UTSW 8 26979754 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTCAGACTGCAAGAACGG -3'
(R):5'- AGTAGGGGTCACGGCATAATC -3'

Sequencing Primer
(F):5'- CTGCAAGAACGGCGGCG -3'
(R):5'- GTCACGGCATAATCCCTGCAG -3'
Posted On2016-10-06