Incidental Mutation 'R5467:Cwc22'
ID433270
Institutional Source Beutler Lab
Gene Symbol Cwc22
Ensembl Gene ENSMUSG00000027014
Gene NameCWC22 spliceosome-associated protein
Synonyms
MMRRC Submission 043028-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5467 (G1)
Quality Score136
Status Not validated
Chromosome2
Chromosomal Location77881159-77946375 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) ATCTCTCTCTCTCTCTCT to ATCTCTCTCTCTCTCT at 77929459 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065889] [ENSMUST00000111818] [ENSMUST00000111819] [ENSMUST00000111821] [ENSMUST00000111824] [ENSMUST00000127289] [ENSMUST00000128963]
Predicted Effect probably null
Transcript: ENSMUST00000065889
SMART Domains Protein: ENSMUSP00000064947
Gene: ENSMUSG00000027014

DomainStartEndE-ValueType
low complexity region 37 98 N/A INTRINSIC
MIF4G 161 344 1e-33 SMART
low complexity region 421 438 N/A INTRINSIC
MA3 454 560 4.45e-26 SMART
low complexity region 669 712 N/A INTRINSIC
low complexity region 746 777 N/A INTRINSIC
low complexity region 847 862 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111818
SMART Domains Protein: ENSMUSP00000107449
Gene: ENSMUSG00000027014

DomainStartEndE-ValueType
low complexity region 37 98 N/A INTRINSIC
MIF4G 161 344 1e-33 SMART
low complexity region 421 438 N/A INTRINSIC
MA3 454 560 4.45e-26 SMART
low complexity region 668 713 N/A INTRINSIC
low complexity region 740 771 N/A INTRINSIC
low complexity region 841 856 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111819
SMART Domains Protein: ENSMUSP00000107450
Gene: ENSMUSG00000027014

DomainStartEndE-ValueType
low complexity region 38 99 N/A INTRINSIC
MIF4G 162 345 1e-33 SMART
low complexity region 422 439 N/A INTRINSIC
MA3 455 561 4.45e-26 SMART
low complexity region 669 714 N/A INTRINSIC
low complexity region 741 772 N/A INTRINSIC
low complexity region 842 857 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111821
SMART Domains Protein: ENSMUSP00000107452
Gene: ENSMUSG00000027014

DomainStartEndE-ValueType
low complexity region 37 98 N/A INTRINSIC
MIF4G 161 344 1e-33 SMART
low complexity region 421 438 N/A INTRINSIC
MA3 454 560 4.45e-26 SMART
low complexity region 669 712 N/A INTRINSIC
low complexity region 746 777 N/A INTRINSIC
low complexity region 847 862 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111824
SMART Domains Protein: ENSMUSP00000107455
Gene: ENSMUSG00000027014

DomainStartEndE-ValueType
low complexity region 37 98 N/A INTRINSIC
MIF4G 161 344 1e-33 SMART
low complexity region 421 438 N/A INTRINSIC
MA3 454 560 4.45e-26 SMART
low complexity region 669 715 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000127289
SMART Domains Protein: ENSMUSP00000122338
Gene: ENSMUSG00000027014

DomainStartEndE-ValueType
low complexity region 38 99 N/A INTRINSIC
PDB:4C9B|B 115 139 2e-9 PDB
Blast:MIF4G 118 139 1e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127351
Predicted Effect probably null
Transcript: ENSMUST00000128963
SMART Domains Protein: ENSMUSP00000115067
Gene: ENSMUSG00000027014

DomainStartEndE-ValueType
low complexity region 37 98 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137494
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144727
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156863
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 94.9%
  • 20x: 89.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,176,217 M525T possibly damaging Het
Arpc5l T C 2: 39,013,739 V80A possibly damaging Het
Atp7b G A 8: 22,011,554 T781I probably damaging Het
Celsr3 A T 9: 108,828,637 D773V probably damaging Het
Clcn6 A T 4: 148,017,636 H330Q possibly damaging Het
D430042O09Rik T C 7: 125,843,355 F812S possibly damaging Het
Dmbt1 C A 7: 131,040,993 S180R probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dusp27 C A 1: 166,112,030 probably null Het
Elovl7 T C 13: 108,279,622 V182A probably benign Het
Eml3 G A 19: 8,937,582 W601* probably null Het
Farp1 C T 14: 121,235,077 P208L probably damaging Het
Fras1 A T 5: 96,780,053 Y3775F probably benign Het
Gm884 G T 11: 103,603,265 C655* probably null Het
Gns T C 10: 121,391,446 W454R probably benign Het
Kcnh2 A T 5: 24,326,767 L40* probably null Het
Kmt2d G A 15: 98,852,109 probably benign Het
Mgl2 T A 11: 70,135,052 I31N possibly damaging Het
Muc6 T C 7: 141,636,535 T2677A possibly damaging Het
Ndst1 A G 18: 60,692,021 S742P probably benign Het
Olfr108 G T 17: 37,446,082 C187F probably damaging Het
Olfr1428 A C 19: 12,108,659 S70A probably benign Het
Olfr1466 A T 19: 13,342,157 Y133F probably damaging Het
Olfr935 T C 9: 38,994,904 Y177C probably benign Het
Olfr981 G T 9: 40,022,437 V15L probably benign Het
Pcdhb22 A G 18: 37,520,135 D552G probably benign Het
Pikfyve T A 1: 65,252,495 V1291E probably damaging Het
Ppp4r3a T C 12: 101,043,470 E636G probably damaging Het
Prl5a1 A T 13: 28,150,011 I166L possibly damaging Het
Rb1 T C 14: 73,211,620 D690G possibly damaging Het
Sh3tc2 A G 18: 61,990,688 H840R possibly damaging Het
Skida1 T C 2: 18,046,112 probably benign Het
Slc31a2 A G 4: 62,292,687 H19R probably damaging Het
Tnks2 A T 19: 36,881,776 R314W probably damaging Het
Trak1 A G 9: 121,446,798 D189G probably damaging Het
Trav13n-4 T A 14: 53,363,846 V24E probably damaging Het
Uhrf1bp1l G T 10: 89,805,099 G711W probably damaging Het
Ylpm1 T C 12: 84,996,859 Y124H unknown Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Cwc22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Cwc22 APN 2 77917064 missense probably benign 0.00
IGL01739:Cwc22 APN 2 77927296 missense probably damaging 1.00
IGL01754:Cwc22 APN 2 77924539 missense probably damaging 0.99
IGL02011:Cwc22 APN 2 77921022 missense possibly damaging 0.88
R0115:Cwc22 UTSW 2 77908111 missense probably damaging 1.00
R0271:Cwc22 UTSW 2 77920858 missense probably benign 0.19
R0481:Cwc22 UTSW 2 77908111 missense probably damaging 1.00
R1086:Cwc22 UTSW 2 77924480 unclassified probably benign
R1165:Cwc22 UTSW 2 77903898 missense probably damaging 0.98
R1394:Cwc22 UTSW 2 77929479 missense possibly damaging 0.91
R1445:Cwc22 UTSW 2 77917177 splice site probably benign
R1448:Cwc22 UTSW 2 77911555 missense probably damaging 1.00
R1640:Cwc22 UTSW 2 77915530 missense possibly damaging 0.82
R1800:Cwc22 UTSW 2 77929453 missense possibly damaging 0.70
R1822:Cwc22 UTSW 2 77924659 unclassified probably benign
R1916:Cwc22 UTSW 2 77905475 missense probably benign 0.28
R2225:Cwc22 UTSW 2 77908151 splice site probably benign
R2360:Cwc22 UTSW 2 77927247 missense probably damaging 1.00
R3113:Cwc22 UTSW 2 77924479 unclassified probably benign
R4962:Cwc22 UTSW 2 77896309 missense probably benign 0.00
R5363:Cwc22 UTSW 2 77929459 frame shift probably null
R5394:Cwc22 UTSW 2 77929339 missense possibly damaging 0.67
R5531:Cwc22 UTSW 2 77924569 missense probably damaging 0.99
R5677:Cwc22 UTSW 2 77929443 missense probably damaging 0.97
R6148:Cwc22 UTSW 2 77929459 frame shift probably null
R6263:Cwc22 UTSW 2 77896171 missense possibly damaging 0.93
R6860:Cwc22 UTSW 2 77929448 missense possibly damaging 0.53
R7133:Cwc22 UTSW 2 77929478 missense possibly damaging 0.91
R7571:Cwc22 UTSW 2 77917067 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCTTCGCAGGAGGGATATAC -3'
(R):5'- GTAAAGAGTGTCACCCTCACGG -3'

Sequencing Primer
(F):5'- GGATATACGCTCCCCCAGTG -3'
(R):5'- TAAGCCTTAGCCCTGAGTCAG -3'
Posted On2016-10-06