Incidental Mutation 'R5467:D430042O09Rik'
ID433277
Institutional Source Beutler Lab
Gene Symbol D430042O09Rik
Ensembl Gene ENSMUSG00000032743
Gene NameRIKEN cDNA D430042O09 gene
Synonyms
MMRRC Submission 043028-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5467 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location125707888-125874793 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125843355 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 812 (F812S)
Ref Sequence ENSEMBL: ENSMUSP00000118668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069660] [ENSMUST00000124223]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069660
AA Change: F838S

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000065744
Gene: ENSMUSG00000032743
AA Change: F838S

DomainStartEndE-ValueType
internal_repeat_3 442 586 9.64e-5 PROSPERO
internal_repeat_2 454 607 1.91e-6 PROSPERO
low complexity region 704 718 N/A INTRINSIC
Pfam:DUF4457 909 1099 5.1e-43 PFAM
Pfam:DUF4457 1205 1524 8.4e-149 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122337
SMART Domains Protein: ENSMUSP00000113734
Gene: ENSMUSG00000032743

DomainStartEndE-ValueType
Pfam:DUF4457 173 344 2.7e-9 PFAM
Pfam:DUF4457 218 394 3.2e-10 PFAM
low complexity region 444 458 N/A INTRINSIC
Pfam:DUF4457 660 742 1.1e-14 PFAM
Pfam:DUF4457 733 863 2.6e-31 PFAM
Pfam:DUF4457 944 1008 5.9e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000124223
AA Change: F812S

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000118668
Gene: ENSMUSG00000032743
AA Change: F812S

DomainStartEndE-ValueType
internal_repeat_3 416 560 8.9e-5 PROSPERO
internal_repeat_2 428 581 1.74e-6 PROSPERO
low complexity region 678 692 N/A INTRINSIC
Pfam:DUF4457 882 1073 1.4e-39 PFAM
Pfam:DUF4457 1179 1498 2.2e-145 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205462
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 94.9%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a novel, evolutionarily conserved, ciliary protein. In human hTERT-RPE1 cells, the protein is found at the base of cilia, decorating the ciliary axoneme, and enriched at the ciliary tip. The protein binds to microtubules in vitro and regulates their stability when it is overexpressed. A null mutation in this gene has been associated with Joubert syndrome, a recessive disorder that is characterized by a distinctive mid-hindbrain and cerebellar malformation and is also often associated with wider ciliopathy symptoms. Consistently, in a serum-starvation ciliogenesis assay, human fibroblast cells derived from patients with the mutation display a reduced number of ciliated cells with abnormally long cilia. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit variable obstructive hydrocephaly and enlarged lateral ventricles resulting from a blockage of cerebrospinal fluid flow in the cerebral aqueduct but show no gross defects in ventricular ependymal cilium structure or motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,176,217 M525T possibly damaging Het
Arpc5l T C 2: 39,013,739 V80A possibly damaging Het
Atp7b G A 8: 22,011,554 T781I probably damaging Het
Celsr3 A T 9: 108,828,637 D773V probably damaging Het
Clcn6 A T 4: 148,017,636 H330Q possibly damaging Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,929,459 probably null Het
Dmbt1 C A 7: 131,040,993 S180R probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dusp27 C A 1: 166,112,030 probably null Het
Elovl7 T C 13: 108,279,622 V182A probably benign Het
Eml3 G A 19: 8,937,582 W601* probably null Het
Farp1 C T 14: 121,235,077 P208L probably damaging Het
Fras1 A T 5: 96,780,053 Y3775F probably benign Het
Gm884 G T 11: 103,603,265 C655* probably null Het
Gns T C 10: 121,391,446 W454R probably benign Het
Kcnh2 A T 5: 24,326,767 L40* probably null Het
Kmt2d G A 15: 98,852,109 probably benign Het
Mgl2 T A 11: 70,135,052 I31N possibly damaging Het
Muc6 T C 7: 141,636,535 T2677A possibly damaging Het
Ndst1 A G 18: 60,692,021 S742P probably benign Het
Olfr108 G T 17: 37,446,082 C187F probably damaging Het
Olfr1428 A C 19: 12,108,659 S70A probably benign Het
Olfr1466 A T 19: 13,342,157 Y133F probably damaging Het
Olfr935 T C 9: 38,994,904 Y177C probably benign Het
Olfr981 G T 9: 40,022,437 V15L probably benign Het
Pcdhb22 A G 18: 37,520,135 D552G probably benign Het
Pikfyve T A 1: 65,252,495 V1291E probably damaging Het
Ppp4r3a T C 12: 101,043,470 E636G probably damaging Het
Prl5a1 A T 13: 28,150,011 I166L possibly damaging Het
Rb1 T C 14: 73,211,620 D690G possibly damaging Het
Sh3tc2 A G 18: 61,990,688 H840R possibly damaging Het
Skida1 T C 2: 18,046,112 probably benign Het
Slc31a2 A G 4: 62,292,687 H19R probably damaging Het
Tnks2 A T 19: 36,881,776 R314W probably damaging Het
Trak1 A G 9: 121,446,798 D189G probably damaging Het
Trav13n-4 T A 14: 53,363,846 V24E probably damaging Het
Uhrf1bp1l G T 10: 89,805,099 G711W probably damaging Het
Ylpm1 T C 12: 84,996,859 Y124H unknown Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in D430042O09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00697:D430042O09Rik APN 7 125795450 missense possibly damaging 0.75
IGL00950:D430042O09Rik APN 7 125843221 missense probably benign
IGL01089:D430042O09Rik APN 7 125795313 missense probably damaging 1.00
IGL01099:D430042O09Rik APN 7 125865320 missense probably damaging 1.00
IGL01449:D430042O09Rik APN 7 125870685 missense probably damaging 1.00
IGL01545:D430042O09Rik APN 7 125752971 critical splice acceptor site probably null
IGL01937:D430042O09Rik APN 7 125854605 missense probably benign 0.13
IGL01949:D430042O09Rik APN 7 125761842 nonsense probably null
IGL02096:D430042O09Rik APN 7 125814821 missense probably benign 0.09
IGL02148:D430042O09Rik APN 7 125873476 unclassified probably null
IGL02274:D430042O09Rik APN 7 125770570 critical splice acceptor site probably null
IGL02323:D430042O09Rik APN 7 125842829 missense probably benign 0.04
IGL02574:D430042O09Rik APN 7 125829753 missense possibly damaging 0.48
IGL02639:D430042O09Rik APN 7 125872792 missense probably damaging 1.00
IGL02833:D430042O09Rik APN 7 125850412 nonsense probably null
IGL03003:D430042O09Rik APN 7 125851960 missense probably damaging 1.00
IGL03011:D430042O09Rik APN 7 125852002 missense probably benign 0.01
IGL03332:D430042O09Rik APN 7 125820105 nonsense probably null
IGL03368:D430042O09Rik APN 7 125868858 intron probably benign
E0370:D430042O09Rik UTSW 7 125850302 missense probably benign 0.06
PIT4498001:D430042O09Rik UTSW 7 125813596 missense probably benign
R0033:D430042O09Rik UTSW 7 125761827 missense possibly damaging 0.77
R0033:D430042O09Rik UTSW 7 125761827 missense possibly damaging 0.77
R0234:D430042O09Rik UTSW 7 125795385 missense probably benign 0.00
R0234:D430042O09Rik UTSW 7 125795385 missense probably benign 0.00
R0472:D430042O09Rik UTSW 7 125872967 missense probably damaging 0.98
R0479:D430042O09Rik UTSW 7 125843346 missense probably benign 0.20
R1195:D430042O09Rik UTSW 7 125866482 missense probably damaging 1.00
R1195:D430042O09Rik UTSW 7 125866482 missense probably damaging 1.00
R1195:D430042O09Rik UTSW 7 125866482 missense probably damaging 1.00
R1223:D430042O09Rik UTSW 7 125760423 missense possibly damaging 0.75
R1299:D430042O09Rik UTSW 7 125852023 missense probably benign
R1331:D430042O09Rik UTSW 7 125866455 missense probably benign 0.00
R1484:D430042O09Rik UTSW 7 125816571 splice site probably benign
R1507:D430042O09Rik UTSW 7 125866352 missense probably damaging 1.00
R1562:D430042O09Rik UTSW 7 125842848 missense probably damaging 1.00
R1992:D430042O09Rik UTSW 7 125820089 missense probably benign 0.00
R2008:D430042O09Rik UTSW 7 125860566 missense probably damaging 1.00
R2010:D430042O09Rik UTSW 7 125872956 missense possibly damaging 0.93
R2147:D430042O09Rik UTSW 7 125865320 missense probably damaging 1.00
R2508:D430042O09Rik UTSW 7 125795343 missense probably benign
R3015:D430042O09Rik UTSW 7 125866340 missense probably damaging 1.00
R3794:D430042O09Rik UTSW 7 125820089 missense probably benign 0.00
R3795:D430042O09Rik UTSW 7 125820089 missense probably benign 0.00
R4043:D430042O09Rik UTSW 7 125868741 missense probably benign 0.30
R4044:D430042O09Rik UTSW 7 125868741 missense probably benign 0.30
R4692:D430042O09Rik UTSW 7 125867669 critical splice donor site probably null
R4772:D430042O09Rik UTSW 7 125865351 missense probably damaging 0.96
R5155:D430042O09Rik UTSW 7 125872184 missense probably damaging 1.00
R5551:D430042O09Rik UTSW 7 125820077 missense probably damaging 1.00
R5560:D430042O09Rik UTSW 7 125854561 missense probably benign 0.00
R5662:D430042O09Rik UTSW 7 125842703 missense probably benign 0.00
R5667:D430042O09Rik UTSW 7 125843455 critical splice donor site probably null
R5838:D430042O09Rik UTSW 7 125867655 missense possibly damaging 0.88
R5958:D430042O09Rik UTSW 7 125813635 missense probably benign 0.01
R5983:D430042O09Rik UTSW 7 125850373 missense probably damaging 1.00
R6084:D430042O09Rik UTSW 7 125814865 missense probably benign
R6241:D430042O09Rik UTSW 7 125872834 missense probably benign 0.00
R6298:D430042O09Rik UTSW 7 125870697 missense probably benign 0.11
R6345:D430042O09Rik UTSW 7 125752987 missense probably damaging 0.97
R6554:D430042O09Rik UTSW 7 125850742 missense probably damaging 1.00
R6715:D430042O09Rik UTSW 7 125761829 nonsense probably null
R6745:D430042O09Rik UTSW 7 125770650 missense probably benign 0.00
R7178:D430042O09Rik UTSW 7 125866327 missense probably benign 0.00
R7210:D430042O09Rik UTSW 7 125872239 missense probably damaging 1.00
R7404:D430042O09Rik UTSW 7 125865262 missense probably damaging 1.00
R7561:D430042O09Rik UTSW 7 125842722 missense probably benign
R7571:D430042O09Rik UTSW 7 125708021 unclassified probably benign
U24488:D430042O09Rik UTSW 7 125770681 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGAAGAGCAGGTTTCCATCTGAG -3'
(R):5'- ACCACCTTTCTGGCTGAGAC -3'

Sequencing Primer
(F):5'- CCATCTGAGGATGTCATGGGTGATAC -3'
(R):5'- GTGATCTCCTACTTGAGAACAGC -3'
Posted On2016-10-06