Mutagenetix > Incidental Mutation

Incidental Mutation 'R5467:Trak1'

433285

Institutional Source

Beutler Lab

Gene Symbol

Trak1

Ensembl Gene

ENSMUSG00000032536

Gene Name

trafficking protein, kinesin binding 1

Synonyms

hyrt, 2310001H13Rik

MMRRC Submission

043028-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.148) question?

Stock #

R5467 (G1)

Quality Score

149

Status

Not validated

Chromosome

Chromosomal Location

121297502-121474918 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 121446798 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 189 (D189G)

Ref Sequence

ENSEMBL: ENSMUSP00000148026 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045903] [ENSMUST00000210351] [ENSMUST00000210636] [ENSMUST00000210798] [ENSMUST00000211187] [ENSMUST00000211301] [ENSMUST00000211439]

AlphaFold

Q6PD31

Predicted Effect

possibly damaging
Transcript: ENSMUST00000045903
AA Change: D292G

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000044482
Gene: ENSMUSG00000032536
AA Change: D292G

Domain	Start	End	E-Value	Type
Pfam:HAP1_N	47	352	8.1e-139	PFAM
Pfam:Milton	411	580	5e-72	PFAM
low complexity region	882	897	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000210351

Predicted Effect

probably benign
Transcript: ENSMUST00000210636

Predicted Effect

probably damaging
Transcript: ENSMUST00000210798
AA Change: D189G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000211187
AA Change: D282G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000211301
AA Change: D189G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000211439
AA Change: D189G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211699

Coding Region Coverage

1x: 98.2%
3x: 97.2%
10x: 94.9%
20x: 89.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice with a spontaneous mutation in this allele have various behavioral abnormalities consistent with hypertonia. Inclusions can be found in neuronal processes of the gray matter of the brainstem and spinal cord. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actn1	A	G	12: 80,176,217	M525T	possibly damaging	Het
Arpc5l	T	C	2: 39,013,739	V80A	possibly damaging	Het
Atp7b	G	A	8: 22,011,554	T781I	probably damaging	Het
Celsr3	A	T	9: 108,828,637	D773V	probably damaging	Het
Clcn6	A	T	4: 148,017,636	H330Q	possibly damaging	Het
Cwc22	ATCTCTCTCTCTCTCTCT	ATCTCTCTCTCTCTCT	2: 77,929,459		probably null	Het
D430042O09Rik	T	C	7: 125,843,355	F812S	possibly damaging	Het
Dmbt1	C	A	7: 131,040,993	S180R	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dusp27	C	A	1: 166,112,030		probably null	Het
Elovl7	T	C	13: 108,279,622	V182A	probably benign	Het
Eml3	G	A	19: 8,937,582	W601*	probably null	Het
Farp1	C	T	14: 121,235,077	P208L	probably damaging	Het
Fras1	A	T	5: 96,780,053	Y3775F	probably benign	Het
Gm884	G	T	11: 103,603,265	C655*	probably null	Het
Gns	T	C	10: 121,391,446	W454R	probably benign	Het
Kcnh2	A	T	5: 24,326,767	L40*	probably null	Het
Kmt2d	G	A	15: 98,852,109		probably benign	Het
Mgl2	T	A	11: 70,135,052	I31N	possibly damaging	Het
Muc6	T	C	7: 141,636,535	T2677A	possibly damaging	Het
Ndst1	A	G	18: 60,692,021	S742P	probably benign	Het
Olfr108	G	T	17: 37,446,082	C187F	probably damaging	Het
Olfr1428	A	C	19: 12,108,659	S70A	probably benign	Het
Olfr1466	A	T	19: 13,342,157	Y133F	probably damaging	Het
Olfr935	T	C	9: 38,994,904	Y177C	probably benign	Het
Olfr981	G	T	9: 40,022,437	V15L	probably benign	Het
Pcdhb22	A	G	18: 37,520,135	D552G	probably benign	Het
Pikfyve	T	A	1: 65,252,495	V1291E	probably damaging	Het
Ppp4r3a	T	C	12: 101,043,470	E636G	probably damaging	Het
Prl5a1	A	T	13: 28,150,011	I166L	possibly damaging	Het
Rb1	T	C	14: 73,211,620	D690G	possibly damaging	Het
Sh3tc2	A	G	18: 61,990,688	H840R	possibly damaging	Het
Skida1	T	C	2: 18,046,112		probably benign	Het
Slc31a2	A	G	4: 62,292,687	H19R	probably damaging	Het
Tnks2	A	T	19: 36,881,776	R314W	probably damaging	Het
Trav13n-4	T	A	14: 53,363,846	V24E	probably damaging	Het
Uhrf1bp1l	G	T	10: 89,805,099	G711W	probably damaging	Het
Ylpm1	T	C	12: 84,996,859	Y124H	unknown	Het
Zfp703	C	T	8: 26,979,205	P299L	probably damaging	Het

Other mutations in Trak1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01308:Trak1	APN	9	121443736	critical splice donor site	probably null
IGL01335:Trak1	APN	9	121454316	missense	possibly damaging	0.58
IGL01777:Trak1	APN	9	121431560	splice site	probably null
IGL01804:Trak1	APN	9	121442685	splice site	probably benign
IGL01986:Trak1	APN	9	121472967	missense	probably benign	0.00
IGL02248:Trak1	APN	9	121446794	missense	probably damaging	1.00
IGL02276:Trak1	APN	9	121451668	missense	probably damaging	1.00
IGL02556:Trak1	APN	9	121448901	missense	probably damaging	1.00
IGL03368:Trak1	APN	9	121367122	missense	possibly damaging	0.66
PIT4468001:Trak1	UTSW	9	121453332	missense	probably benign	0.18
R0067:Trak1	UTSW	9	121472907	missense	probably damaging	1.00
R0276:Trak1	UTSW	9	121454338	missense	probably damaging	0.97
R0535:Trak1	UTSW	9	121443712	missense	probably null	1.00
R0629:Trak1	UTSW	9	121367167	missense	probably benign	0.37
R0671:Trak1	UTSW	9	121448955	critical splice donor site	probably null
R0883:Trak1	UTSW	9	121453285	missense	possibly damaging	0.90
R1160:Trak1	UTSW	9	121392007	missense	probably benign	0.01
R1162:Trak1	UTSW	9	121453341	missense	possibly damaging	0.93
R1168:Trak1	UTSW	9	121440679	missense	probably damaging	1.00
R1398:Trak1	UTSW	9	121454359	missense	probably damaging	1.00
R2118:Trak1	UTSW	9	121472997	makesense	probably null
R2119:Trak1	UTSW	9	121472997	makesense	probably null
R2120:Trak1	UTSW	9	121472997	makesense	probably null
R2137:Trak1	UTSW	9	121472962	missense	possibly damaging	0.83
R3162:Trak1	UTSW	9	121451734	splice site	probably benign
R3888:Trak1	UTSW	9	121442797	splice site	probably null
R3889:Trak1	UTSW	9	121445873	missense	probably null	0.40
R4031:Trak1	UTSW	9	121451670	missense	probably damaging	1.00
R4116:Trak1	UTSW	9	121448843	missense	probably damaging	1.00
R4406:Trak1	UTSW	9	121431536	missense	probably damaging	1.00
R4630:Trak1	UTSW	9	121454425	missense	probably benign	0.02
R4631:Trak1	UTSW	9	121454425	missense	probably benign	0.02
R4632:Trak1	UTSW	9	121454425	missense	probably benign	0.02
R4786:Trak1	UTSW	9	121472494	missense	probably benign	0.25
R5137:Trak1	UTSW	9	121367055	intron	probably benign
R5159:Trak1	UTSW	9	121460412	missense	probably damaging	0.99
R5661:Trak1	UTSW	9	121443637	missense	possibly damaging	0.46
R5664:Trak1	UTSW	9	121472307	missense	possibly damaging	0.47
R5769:Trak1	UTSW	9	121448838	missense	probably damaging	1.00
R6041:Trak1	UTSW	9	121460412	missense	probably damaging	0.99
R6257:Trak1	UTSW	9	121446755	missense	probably damaging	1.00
R6257:Trak1	UTSW	9	121367224	missense	possibly damaging	0.92
R6354:Trak1	UTSW	9	121451726	missense	probably null	0.03
R6399:Trak1	UTSW	9	121453496	splice site	probably null
R6513:Trak1	UTSW	9	121443756	missense	probably benign
R6579:Trak1	UTSW	9	121443638	missense	probably benign	0.29
R6940:Trak1	UTSW	9	121443718	missense	possibly damaging	0.78
R7120:Trak1	UTSW	9	121460498	missense	probably benign
R7299:Trak1	UTSW	9	121451863	splice site	probably null
R7304:Trak1	UTSW	9	121416212	missense	probably benign
R7396:Trak1	UTSW	9	121448907	missense	possibly damaging	0.71
R7522:Trak1	UTSW	9	121442711	missense	probably damaging	0.99
R7657:Trak1	UTSW	9	121472586	missense	probably damaging	1.00
R7733:Trak1	UTSW	9	121367225	missense	possibly damaging	0.92
R7793:Trak1	UTSW	9	121416198	nonsense	probably null
R7999:Trak1	UTSW	9	121460425	missense	probably damaging	1.00
R8209:Trak1	UTSW	9	121451727	missense	probably benign
R8215:Trak1	UTSW	9	121469030	missense	probably damaging	1.00
R8226:Trak1	UTSW	9	121451727	missense	probably benign
R8261:Trak1	UTSW	9	121451667	missense	probably damaging	1.00
R8300:Trak1	UTSW	9	121460499	nonsense	probably null
R8914:Trak1	UTSW	9	121443781	missense	unknown
R9072:Trak1	UTSW	9	121460488	missense	probably damaging	1.00
R9073:Trak1	UTSW	9	121460488	missense	probably damaging	1.00
R9312:Trak1	UTSW	9	121451691	missense	probably benign	0.01
R9366:Trak1	UTSW	9	121472512	missense	probably damaging	1.00
R9663:Trak1	UTSW	9	121391858	missense	probably benign	0.18

Predicted Primers

PCR Primer
(F):5'- AAGACGGTGTTCCCTCTTTG -3'
(R):5'- TAGATCACCCTTAGGAGCAACATC -3'

Sequencing Primer
(F):5'- GGTCTGTGTGTGGCTTTCCAAC -3'
(R):5'- TAACGCCTCGGCCAACCTG -3'

Posted On

2016-10-06