Incidental Mutation 'R5467:Actn1'
ID433290
Institutional Source Beutler Lab
Gene Symbol Actn1
Ensembl Gene ENSMUSG00000015143
Gene Nameactinin, alpha 1
Synonyms
MMRRC Submission 043028-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.345) question?
Stock #R5467 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location80167547-80260371 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80176217 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 525 (M525T)
Ref Sequence ENSEMBL: ENSMUSP00000127176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021554] [ENSMUST00000167327]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021554
AA Change: M525T

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021554
Gene: ENSMUSG00000015143
AA Change: M525T

DomainStartEndE-ValueType
CH 33 133 4.24e-23 SMART
CH 146 245 5.06e-21 SMART
Pfam:Spectrin 274 384 5.9e-17 PFAM
SPEC 397 498 1.69e-25 SMART
SPEC 512 619 1.47e-2 SMART
Pfam:Spectrin 630 733 4.7e-14 PFAM
EFh 750 778 1.73e-5 SMART
EFh 791 819 8.13e-2 SMART
efhand_Ca_insen 822 888 5.22e-38 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167327
AA Change: M525T

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127176
Gene: ENSMUSG00000015143
AA Change: M525T

DomainStartEndE-ValueType
CH 33 133 4.24e-23 SMART
CH 146 245 5.06e-21 SMART
Pfam:Spectrin 274 384 1.7e-17 PFAM
SPEC 397 498 1.69e-25 SMART
SPEC 512 619 1.47e-2 SMART
Pfam:Spectrin 630 733 8.4e-14 PFAM
EFh 750 778 1.36e0 SMART
EFh 786 814 8.13e-2 SMART
efhand_Ca_insen 817 883 5.22e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219634
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 94.9%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a nonmuscle, cytoskeletal, alpha actinin isoform and maps to the same site as the structurally similar erythroid beta spectrin gene. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arpc5l T C 2: 39,013,739 V80A possibly damaging Het
Atp7b G A 8: 22,011,554 T781I probably damaging Het
Celsr3 A T 9: 108,828,637 D773V probably damaging Het
Clcn6 A T 4: 148,017,636 H330Q possibly damaging Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,929,459 probably null Het
D430042O09Rik T C 7: 125,843,355 F812S possibly damaging Het
Dmbt1 C A 7: 131,040,993 S180R probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dusp27 C A 1: 166,112,030 probably null Het
Elovl7 T C 13: 108,279,622 V182A probably benign Het
Eml3 G A 19: 8,937,582 W601* probably null Het
Farp1 C T 14: 121,235,077 P208L probably damaging Het
Fras1 A T 5: 96,780,053 Y3775F probably benign Het
Gm884 G T 11: 103,603,265 C655* probably null Het
Gns T C 10: 121,391,446 W454R probably benign Het
Kcnh2 A T 5: 24,326,767 L40* probably null Het
Kmt2d G A 15: 98,852,109 probably benign Het
Mgl2 T A 11: 70,135,052 I31N possibly damaging Het
Muc6 T C 7: 141,636,535 T2677A possibly damaging Het
Ndst1 A G 18: 60,692,021 S742P probably benign Het
Olfr108 G T 17: 37,446,082 C187F probably damaging Het
Olfr1428 A C 19: 12,108,659 S70A probably benign Het
Olfr1466 A T 19: 13,342,157 Y133F probably damaging Het
Olfr935 T C 9: 38,994,904 Y177C probably benign Het
Olfr981 G T 9: 40,022,437 V15L probably benign Het
Pcdhb22 A G 18: 37,520,135 D552G probably benign Het
Pikfyve T A 1: 65,252,495 V1291E probably damaging Het
Ppp4r3a T C 12: 101,043,470 E636G probably damaging Het
Prl5a1 A T 13: 28,150,011 I166L possibly damaging Het
Rb1 T C 14: 73,211,620 D690G possibly damaging Het
Sh3tc2 A G 18: 61,990,688 H840R possibly damaging Het
Skida1 T C 2: 18,046,112 probably benign Het
Slc31a2 A G 4: 62,292,687 H19R probably damaging Het
Tnks2 A T 19: 36,881,776 R314W probably damaging Het
Trak1 A G 9: 121,446,798 D189G probably damaging Het
Trav13n-4 T A 14: 53,363,846 V24E probably damaging Het
Uhrf1bp1l G T 10: 89,805,099 G711W probably damaging Het
Ylpm1 T C 12: 84,996,859 Y124H unknown Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Actn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Actn1 APN 12 80199072 splice site probably null
IGL01152:Actn1 APN 12 80199046 missense probably damaging 1.00
IGL01386:Actn1 APN 12 80193672 missense probably benign 0.03
IGL01890:Actn1 APN 12 80184868 missense probably damaging 0.99
IGL01937:Actn1 APN 12 80171763 missense probably benign 0.03
IGL02142:Actn1 APN 12 80176155 critical splice donor site probably null
IGL02191:Actn1 APN 12 80174109 missense probably benign
IGL02217:Actn1 APN 12 80174094 nonsense probably null
IGL02230:Actn1 APN 12 80171830 missense probably benign 0.02
IGL03163:Actn1 APN 12 80181417 missense probably benign 0.33
IGL03401:Actn1 APN 12 80168967 nonsense probably null
R0538:Actn1 UTSW 12 80260100 unclassified probably benign
R0546:Actn1 UTSW 12 80178434 missense probably benign
R0583:Actn1 UTSW 12 80199029 missense probably damaging 1.00
R0606:Actn1 UTSW 12 80174647 splice site probably benign
R1340:Actn1 UTSW 12 80173144 critical splice acceptor site probably null
R1519:Actn1 UTSW 12 80205078 missense probably damaging 1.00
R1572:Actn1 UTSW 12 80172957 splice site probably benign
R1619:Actn1 UTSW 12 80173022 missense probably damaging 1.00
R1677:Actn1 UTSW 12 80260032 missense probably benign 0.02
R1994:Actn1 UTSW 12 80204971 nonsense probably null
R2102:Actn1 UTSW 12 80183517 missense probably benign 0.38
R2157:Actn1 UTSW 12 80173117 missense probably benign 0.04
R2191:Actn1 UTSW 12 80171802 nonsense probably null
R2519:Actn1 UTSW 12 80192389 missense probably damaging 1.00
R2988:Actn1 UTSW 12 80192388 missense possibly damaging 0.78
R4024:Actn1 UTSW 12 80168477 missense probably damaging 1.00
R4589:Actn1 UTSW 12 80171799 missense possibly damaging 0.53
R4907:Actn1 UTSW 12 80181414 missense probably damaging 0.99
R4936:Actn1 UTSW 12 80172998 missense probably benign 0.09
R4966:Actn1 UTSW 12 80173130 missense probably benign 0.01
R4972:Actn1 UTSW 12 80173039 missense probably benign 0.35
R5395:Actn1 UTSW 12 80170703 missense probably benign
R5460:Actn1 UTSW 12 80183568 missense probably benign 0.00
R5470:Actn1 UTSW 12 80168941 missense probably damaging 0.99
R5661:Actn1 UTSW 12 80184844 missense probably benign 0.09
R5985:Actn1 UTSW 12 80168395 missense probably damaging 1.00
R6020:Actn1 UTSW 12 80174455 splice site probably null
R6042:Actn1 UTSW 12 80177249 missense probably benign 0.04
R6389:Actn1 UTSW 12 80174522 missense probably benign
R6499:Actn1 UTSW 12 80168417 missense possibly damaging 0.59
R6709:Actn1 UTSW 12 80193644 missense probably damaging 1.00
R7016:Actn1 UTSW 12 80172968 missense possibly damaging 0.94
R7116:Actn1 UTSW 12 80204977 missense probably damaging 1.00
R7173:Actn1 UTSW 12 80177259 missense possibly damaging 0.70
R7183:Actn1 UTSW 12 80168932 missense possibly damaging 0.87
R7291:Actn1 UTSW 12 80174085 missense probably benign 0.00
R7361:Actn1 UTSW 12 80193715 missense probably benign 0.01
R7452:Actn1 UTSW 12 80183602 missense probably benign 0.12
R7698:Actn1 UTSW 12 80174537 missense probably benign 0.00
R7701:Actn1 UTSW 12 80174554 missense possibly damaging 0.88
R8000:Actn1 UTSW 12 80199008 missense probably damaging 1.00
R8171:Actn1 UTSW 12 80196393 critical splice donor site probably null
R8287:Actn1 UTSW 12 80174078 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATCTTTACAAACGCGTGACCTC -3'
(R):5'- GTGAGATGCCCTGTCAATTGAC -3'

Sequencing Primer
(F):5'- ACGCGTGACCTCATATGC -3'
(R):5'- AAGAGCCGGTTCTTTCTGC -3'
Posted On2016-10-06