Incidental Mutation 'R5468:Cenpf'
ID433310
Institutional Source Beutler Lab
Gene Symbol Cenpf
Ensembl Gene ENSMUSG00000026605
Gene Namecentromere protein F
Synonymsmitosin, 6530404A22Rik, Lek1
MMRRC Submission 043029-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.614) question?
Stock #R5468 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location189640606-189688086 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 189652371 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 2571 (S2571T)
Ref Sequence ENSEMBL: ENSMUSP00000129738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171929]
Predicted Effect probably benign
Transcript: ENSMUST00000165798
SMART Domains Protein: ENSMUSP00000132430
Gene: ENSMUSG00000026605

DomainStartEndE-ValueType
Pfam:CENP-F_C_Rb_bdg 23 50 1.6e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171929
AA Change: S2571T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129738
Gene: ENSMUSG00000026605
AA Change: S2571T

DomainStartEndE-ValueType
Pfam:CENP-F_N 1 300 2.8e-144 PFAM
low complexity region 349 364 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 589 609 N/A INTRINSIC
internal_repeat_5 678 707 8.32e-5 PROSPERO
internal_repeat_3 743 798 2.21e-5 PROSPERO
internal_repeat_1 780 812 2.12e-7 PROSPERO
coiled coil region 829 881 N/A INTRINSIC
coiled coil region 902 1169 N/A INTRINSIC
coiled coil region 1206 1364 N/A INTRINSIC
internal_repeat_2 1381 1413 3.02e-6 PROSPERO
internal_repeat_3 1412 1470 2.21e-5 PROSPERO
low complexity region 1526 1542 N/A INTRINSIC
coiled coil region 1560 1650 N/A INTRINSIC
internal_repeat_2 1655 1687 3.02e-6 PROSPERO
low complexity region 1744 1755 N/A INTRINSIC
coiled coil region 1822 1852 N/A INTRINSIC
Pfam:CENP-F_leu_zip 1893 2035 1.2e-14 PFAM
Pfam:CENP-F_leu_zip 2131 2270 1.5e-47 PFAM
Pfam:CENP-F_leu_zip 2313 2449 1e-46 PFAM
low complexity region 2544 2555 N/A INTRINSIC
low complexity region 2642 2654 N/A INTRINSIC
low complexity region 2755 2769 N/A INTRINSIC
internal_repeat_4 2778 2801 4.28e-5 PROSPERO
low complexity region 2837 2847 N/A INTRINSIC
Pfam:CENP-F_C_Rb_bdg 2850 2896 6.6e-29 PFAM
internal_repeat_1 2935 2964 2.12e-7 PROSPERO
internal_repeat_4 2946 2969 4.28e-5 PROSPERO
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that associates with the centromere-kinetochore complex. The protein is a component of the nuclear matrix during the G2 phase of interphase. In late G2 the protein associates with the kinetochore and maintains this association through early anaphase. It localizes to the spindle midzone and the intracellular bridge in late anaphase and telophase, respectively, and is thought to be subsequently degraded. The localization of this protein suggests that it may play a role in chromosome segregation during mitotis. It is thought to form either a homodimer or heterodimer. Autoantibodies against this protein have been found in patients with cancer or graft versus host disease. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik C T 7: 44,360,235 R181Q probably damaging Het
Abca13 T A 11: 9,294,062 L1975Q probably damaging Het
Acp2 T A 2: 91,206,098 I180N probably benign Het
Adam12 T C 7: 133,975,473 D221G probably damaging Het
Adamts4 A G 1: 171,252,609 T244A probably benign Het
Adrb2 A T 18: 62,179,625 I43N probably damaging Het
Anxa1 A T 19: 20,378,483 Y207N probably damaging Het
Apba2 T C 7: 64,745,762 L662P probably damaging Het
Arhgap18 T A 10: 26,912,671 I593K probably damaging Het
Arsj T C 3: 126,438,388 V261A possibly damaging Het
Atp7b A T 8: 22,059,970 probably null Het
C2cd2 C T 16: 97,868,591 probably null Het
C530008M17Rik A T 5: 76,840,763 probably benign Het
Cep162 A C 9: 87,227,237 L438V probably benign Het
Cfap74 A T 4: 155,426,041 N361I probably benign Het
Cntn5 A G 9: 9,743,628 I548T probably damaging Het
Dglucy A G 12: 100,850,335 N382S probably benign Het
Dnah10 C A 5: 124,830,493 N4306K probably damaging Het
Fam181a A T 12: 103,316,678 M281L probably benign Het
Fam186b A G 15: 99,278,870 I713T possibly damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fry A T 5: 150,399,588 Y1068F probably benign Het
Fubp3 A G 2: 31,603,235 I231V probably benign Het
Gbf1 A G 19: 46,284,296 D1681G possibly damaging Het
Gm10999 G A 8: 129,131,649 P5S probably damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Impg1 T C 9: 80,465,265 I9V probably benign Het
Lama4 A G 10: 39,072,682 probably null Het
Lamc1 A G 1: 153,233,564 S1161P probably damaging Het
Lipm T A 19: 34,109,554 probably null Het
Lrrc7 G T 3: 158,318,436 N107K probably damaging Het
Lypd8 T C 11: 58,386,760 S123P probably damaging Het
Man2a2 T C 7: 80,352,981 D1084G probably damaging Het
Man2b2 A G 5: 36,807,175 S1000P probably benign Het
Ms4a7 C T 19: 11,322,414 C71Y probably benign Het
Mtus1 A G 8: 41,084,578 S34P probably benign Het
Myo3b A G 2: 70,234,441 N406S probably benign Het
Nbr1 A T 11: 101,572,464 M586L probably benign Het
Nfatc1 C T 18: 80,649,855 R677H probably benign Het
Nlrc3 A C 16: 3,964,035 S503R probably damaging Het
Nlrp9c A T 7: 26,365,000 F968I probably benign Het
Olfr340 A T 2: 36,453,443 N286I probably damaging Het
Olfr881 G A 9: 37,993,011 C168Y probably damaging Het
Olfr951 A G 9: 39,393,961 N57D probably benign Het
Onecut1 A T 9: 74,863,332 T346S probably damaging Het
Pclo A T 5: 14,680,952 K3156M unknown Het
Pigo C T 4: 43,024,562 probably null Het
Plcb4 T C 2: 135,967,152 F580S probably damaging Het
Plekhm2 G T 4: 141,628,100 P879H probably damaging Het
Ppm1e T A 11: 87,230,890 Y747F probably benign Het
Ppwd1 A G 13: 104,225,444 F69L possibly damaging Het
Prss27 C A 17: 24,038,313 Q3K possibly damaging Het
Prss29 T A 17: 25,321,046 N139K possibly damaging Het
Qrich2 T A 11: 116,448,365 T1777S probably damaging Het
Rbp3 A T 14: 33,956,627 H844L possibly damaging Het
Rubcnl G A 14: 75,032,031 C43Y possibly damaging Het
Sec14l5 A G 16: 5,167,140 probably null Het
Sepsecs A T 5: 52,644,014 N435K probably damaging Het
Sfrp1 A G 8: 23,446,210 K223E probably benign Het
Sh3tc2 G A 18: 61,973,431 probably null Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Tmprss7 A G 16: 45,656,448 F817S probably damaging Het
Tril T C 6: 53,819,647 N197D probably damaging Het
Tspan18 T C 2: 93,209,862 T183A probably benign Het
Uroc1 A T 6: 90,338,604 M156L probably benign Het
Wnt16 T C 6: 22,291,161 V196A probably benign Het
Xpnpep1 A G 19: 52,995,519 Y592H probably benign Het
Zfp553 T C 7: 127,237,030 S586P probably benign Het
Zfp619 C T 7: 39,535,728 A394V unknown Het
Zfp985 A G 4: 147,583,245 Y190C probably benign Het
Zmynd10 T A 9: 107,550,337 D309E probably benign Het
Zmynd15 T C 11: 70,461,820 L73P probably damaging Het
Other mutations in Cenpf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Cenpf APN 1 189654912 missense probably benign 0.01
IGL01154:Cenpf APN 1 189680333 missense probably benign 0.19
IGL01434:Cenpf APN 1 189657868 nonsense probably null
IGL01461:Cenpf APN 1 189657096 missense probably damaging 1.00
IGL01615:Cenpf APN 1 189653184 missense possibly damaging 0.68
IGL01720:Cenpf APN 1 189682386 missense probably benign 0.05
IGL01720:Cenpf APN 1 189651215 missense probably damaging 0.99
IGL01803:Cenpf APN 1 189654771 nonsense probably null
IGL02152:Cenpf APN 1 189649012 missense probably benign
IGL02222:Cenpf APN 1 189654444 missense probably benign
IGL02338:Cenpf APN 1 189680418 missense probably damaging 1.00
IGL02580:Cenpf APN 1 189657441 missense probably benign 0.20
IGL02629:Cenpf APN 1 189652334 missense probably damaging 1.00
IGL02650:Cenpf APN 1 189652473 missense possibly damaging 0.91
IGL02660:Cenpf APN 1 189654782 missense probably damaging 1.00
IGL02703:Cenpf APN 1 189659758 missense probably benign 0.14
IGL02809:Cenpf APN 1 189682358 splice site probably benign
IGL02851:Cenpf APN 1 189658030 missense probably damaging 1.00
IGL02903:Cenpf APN 1 189646876 missense probably damaging 0.99
IGL03126:Cenpf APN 1 189659010 missense probably damaging 1.00
IGL03235:Cenpf APN 1 189683927 missense probably damaging 1.00
IGL03336:Cenpf APN 1 189652647 missense probably damaging 0.99
IGL03402:Cenpf APN 1 189655076 missense probably damaging 1.00
IGL02799:Cenpf UTSW 1 189659652 missense probably damaging 1.00
R0011:Cenpf UTSW 1 189650706 missense probably benign 0.05
R0129:Cenpf UTSW 1 189659650 missense probably benign 0.26
R0157:Cenpf UTSW 1 189652359 missense probably benign 0.07
R0270:Cenpf UTSW 1 189650714 missense probably benign 0.01
R0607:Cenpf UTSW 1 189682463 splice site probably null
R0621:Cenpf UTSW 1 189672628 missense probably benign
R0639:Cenpf UTSW 1 189658062 missense probably benign 0.01
R0653:Cenpf UTSW 1 189659986 missense probably damaging 1.00
R0718:Cenpf UTSW 1 189653984 missense probably damaging 1.00
R1157:Cenpf UTSW 1 189658453 missense probably benign 0.20
R1331:Cenpf UTSW 1 189642801 missense probably damaging 0.99
R1463:Cenpf UTSW 1 189654739 missense probably damaging 0.97
R1514:Cenpf UTSW 1 189679141 missense possibly damaging 0.67
R1529:Cenpf UTSW 1 189660038 missense probably benign 0.00
R1574:Cenpf UTSW 1 189652713 missense probably damaging 1.00
R1574:Cenpf UTSW 1 189652713 missense probably damaging 1.00
R1662:Cenpf UTSW 1 189657771 missense probably damaging 0.99
R1671:Cenpf UTSW 1 189679144 splice site probably null
R1725:Cenpf UTSW 1 189680479 missense probably damaging 0.99
R1743:Cenpf UTSW 1 189654263 missense probably benign 0.19
R1874:Cenpf UTSW 1 189683816 missense probably damaging 1.00
R1884:Cenpf UTSW 1 189646849 missense probably benign
R1980:Cenpf UTSW 1 189653915 missense probably benign 0.04
R2074:Cenpf UTSW 1 189656901 missense probably damaging 1.00
R2096:Cenpf UTSW 1 189653459 missense possibly damaging 0.95
R2109:Cenpf UTSW 1 189679067 missense probably damaging 0.99
R2113:Cenpf UTSW 1 189679102 missense probably damaging 0.96
R2134:Cenpf UTSW 1 189658642 missense probably benign 0.03
R2209:Cenpf UTSW 1 189652598 missense probably benign 0.04
R2875:Cenpf UTSW 1 189658644 missense probably benign 0.11
R2876:Cenpf UTSW 1 189658644 missense probably benign 0.11
R3433:Cenpf UTSW 1 189659949 missense probably damaging 0.99
R3709:Cenpf UTSW 1 189648812 missense possibly damaging 0.72
R3786:Cenpf UTSW 1 189658337 missense probably damaging 1.00
R4014:Cenpf UTSW 1 189653159 missense probably benign 0.01
R4108:Cenpf UTSW 1 189683868 missense probably damaging 1.00
R4119:Cenpf UTSW 1 189653045 missense probably benign 0.01
R4177:Cenpf UTSW 1 189668619 missense possibly damaging 0.95
R4422:Cenpf UTSW 1 189658350 missense probably damaging 1.00
R4546:Cenpf UTSW 1 189654650 missense probably damaging 1.00
R4592:Cenpf UTSW 1 189679033 missense probably damaging 1.00
R4643:Cenpf UTSW 1 189659589 missense probably benign 0.00
R4650:Cenpf UTSW 1 189660038 missense probably benign 0.00
R4801:Cenpf UTSW 1 189651220 missense probably damaging 1.00
R4802:Cenpf UTSW 1 189651220 missense probably damaging 1.00
R4817:Cenpf UTSW 1 189682369 missense possibly damaging 0.93
R4871:Cenpf UTSW 1 189658531 missense probably damaging 1.00
R5037:Cenpf UTSW 1 189683846 missense probably damaging 1.00
R5106:Cenpf UTSW 1 189683808 missense probably benign 0.00
R5208:Cenpf UTSW 1 189671046 critical splice donor site probably null
R5213:Cenpf UTSW 1 189654980 missense probably benign 0.04
R5237:Cenpf UTSW 1 189659533 missense probably benign 0.28
R5255:Cenpf UTSW 1 189672627 missense possibly damaging 0.49
R5378:Cenpf UTSW 1 189653466 missense possibly damaging 0.95
R5510:Cenpf UTSW 1 189682903 missense probably benign 0.14
R5616:Cenpf UTSW 1 189657286 missense probably damaging 1.00
R5652:Cenpf UTSW 1 189657082 missense probably damaging 0.99
R5735:Cenpf UTSW 1 189654363 missense probably benign 0.10
R5841:Cenpf UTSW 1 189657444 missense possibly damaging 0.90
R5943:Cenpf UTSW 1 189659969 missense possibly damaging 0.75
R6082:Cenpf UTSW 1 189658104 missense probably benign 0.11
R6108:Cenpf UTSW 1 189662013 missense probably benign 0.03
R6269:Cenpf UTSW 1 189659920 missense probably benign 0.37
R6284:Cenpf UTSW 1 189652742 missense probably damaging 1.00
R6425:Cenpf UTSW 1 189659898 missense probably benign 0.09
R6587:Cenpf UTSW 1 189658374 missense probably damaging 1.00
R6747:Cenpf UTSW 1 189652854 missense probably benign 0.15
R6811:Cenpf UTSW 1 189654542 missense probably benign 0.06
R6834:Cenpf UTSW 1 189659446 missense probably damaging 1.00
R6951:Cenpf UTSW 1 189653792 missense probably damaging 1.00
R7095:Cenpf UTSW 1 189659176 missense probably benign 0.01
R7128:Cenpf UTSW 1 189684991 missense probably damaging 1.00
R7185:Cenpf UTSW 1 189653489 missense probably damaging 1.00
R7292:Cenpf UTSW 1 189650694 missense probably damaging 1.00
R7353:Cenpf UTSW 1 189654138 nonsense probably null
R7402:Cenpf UTSW 1 189659378 nonsense probably null
R7460:Cenpf UTSW 1 189654050 missense probably damaging 0.97
R7484:Cenpf UTSW 1 189656821 missense probably damaging 1.00
R7574:Cenpf UTSW 1 189658667 missense probably damaging 1.00
R7691:Cenpf UTSW 1 189658207 nonsense probably null
R7698:Cenpf UTSW 1 189662072 missense probably benign 0.01
RF006:Cenpf UTSW 1 189657386 missense probably damaging 1.00
X0025:Cenpf UTSW 1 189653874 missense possibly damaging 0.79
X0066:Cenpf UTSW 1 189657929 missense probably benign 0.23
Z1088:Cenpf UTSW 1 189652931 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCCCTGTAGTCAAGACCATG -3'
(R):5'- GCCCTCACTCAAGAAGTAGAAG -3'

Sequencing Primer
(F):5'- GTCCCTGTAGTCAAGACCATGTAAAC -3'
(R):5'- CTCACTCAAGAAGTAGAAGCTGGC -3'
Posted On2016-10-06