Mutagenetix > Incidental Mutations

Incidental Mutation 'R5468:Cenpf'

433310

Institutional Source

Beutler Lab

Gene Symbol

Cenpf

Ensembl Gene

ENSMUSG00000026605

Gene Name

centromere protein F

Synonyms

mitosin, 6530404A22Rik, Lek1

MMRRC Submission

043029-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.614) question?

Stock #

R5468 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

189640606-189688086 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 189652371 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 2571 (S2571T)

Ref Sequence

ENSEMBL: ENSMUSP00000129738 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000171929]

Predicted Effect

probably benign
Transcript: ENSMUST00000165798

SMART Domains

Protein: ENSMUSP00000132430
Gene: ENSMUSG00000026605

Domain	Start	End	E-Value	Type
Pfam:CENP-F_C_Rb_bdg	23	50	1.6e-17	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000171929
AA Change: S2571T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000129738
Gene: ENSMUSG00000026605
AA Change: S2571T

Domain	Start	End	E-Value	Type
Pfam:CENP-F_N	1	300	2.8e-144	PFAM
low complexity region	349	364	N/A	INTRINSIC
low complexity region	378	396	N/A	INTRINSIC
low complexity region	544	557	N/A	INTRINSIC
low complexity region	589	609	N/A	INTRINSIC
internal_repeat_5	678	707	8.32e-5	PROSPERO
internal_repeat_3	743	798	2.21e-5	PROSPERO
internal_repeat_1	780	812	2.12e-7	PROSPERO
coiled coil region	829	881	N/A	INTRINSIC
coiled coil region	902	1169	N/A	INTRINSIC
coiled coil region	1206	1364	N/A	INTRINSIC
internal_repeat_2	1381	1413	3.02e-6	PROSPERO
internal_repeat_3	1412	1470	2.21e-5	PROSPERO
low complexity region	1526	1542	N/A	INTRINSIC
coiled coil region	1560	1650	N/A	INTRINSIC
internal_repeat_2	1655	1687	3.02e-6	PROSPERO
low complexity region	1744	1755	N/A	INTRINSIC
coiled coil region	1822	1852	N/A	INTRINSIC
Pfam:CENP-F_leu_zip	1893	2035	1.2e-14	PFAM
Pfam:CENP-F_leu_zip	2131	2270	1.5e-47	PFAM
Pfam:CENP-F_leu_zip	2313	2449	1e-46	PFAM
low complexity region	2544	2555	N/A	INTRINSIC
low complexity region	2642	2654	N/A	INTRINSIC
low complexity region	2755	2769	N/A	INTRINSIC
internal_repeat_4	2778	2801	4.28e-5	PROSPERO
low complexity region	2837	2847	N/A	INTRINSIC
Pfam:CENP-F_C_Rb_bdg	2850	2896	6.6e-29	PFAM
internal_repeat_1	2935	2964	2.12e-7	PROSPERO
internal_repeat_4	2946	2969	4.28e-5	PROSPERO

Coding Region Coverage

1x: 98.2%
3x: 97.3%
10x: 95.2%
20x: 91.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that associates with the centromere-kinetochore complex. The protein is a component of the nuclear matrix during the G2 phase of interphase. In late G2 the protein associates with the kinetochore and maintains this association through early anaphase. It localizes to the spindle midzone and the intracellular bridge in late anaphase and telophase, respectively, and is thought to be subsequently degraded. The localization of this protein suggests that it may play a role in chromosome segregation during mitotis. It is thought to form either a homodimer or heterodimer. Autoantibodies against this protein have been found in patients with cancer or graft versus host disease. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700008O03Rik	C	T	7: 44,360,235	R181Q	probably damaging	Het
Abca13	T	A	11: 9,294,062	L1975Q	probably damaging	Het
Acp2	T	A	2: 91,206,098	I180N	probably benign	Het
Adam12	T	C	7: 133,975,473	D221G	probably damaging	Het
Adamts4	A	G	1: 171,252,609	T244A	probably benign	Het
Adrb2	A	T	18: 62,179,625	I43N	probably damaging	Het
Anxa1	A	T	19: 20,378,483	Y207N	probably damaging	Het
Apba2	T	C	7: 64,745,762	L662P	probably damaging	Het
Arhgap18	T	A	10: 26,912,671	I593K	probably damaging	Het
Arsj	T	C	3: 126,438,388	V261A	possibly damaging	Het
Atp7b	A	T	8: 22,059,970		probably null	Het
C2cd2	C	T	16: 97,868,591		probably null	Het
C530008M17Rik	A	T	5: 76,840,763		probably benign	Het
Cep162	A	C	9: 87,227,237	L438V	probably benign	Het
Cfap74	A	T	4: 155,426,041	N361I	probably benign	Het
Cntn5	A	G	9: 9,743,628	I548T	probably damaging	Het
Dglucy	A	G	12: 100,850,335	N382S	probably benign	Het
Dnah10	C	A	5: 124,830,493	N4306K	probably damaging	Het
Fam181a	A	T	12: 103,316,678	M281L	probably benign	Het
Fam186b	A	G	15: 99,278,870	I713T	possibly damaging	Het
Fetub	C	T	16: 22,932,331	R143C	probably damaging	Het
Fry	A	T	5: 150,399,588	Y1068F	probably benign	Het
Fubp3	A	G	2: 31,603,235	I231V	probably benign	Het
Gbf1	A	G	19: 46,284,296	D1681G	possibly damaging	Het
Gm10999	G	A	8: 129,131,649	P5S	probably damaging	Het
Gm12689	T	C	4: 99,296,165	I85T	unknown	Het
Impg1	T	C	9: 80,465,265	I9V	probably benign	Het
Lama4	A	G	10: 39,072,682		probably null	Het
Lamc1	A	G	1: 153,233,564	S1161P	probably damaging	Het
Lipm	T	A	19: 34,109,554		probably null	Het
Lrrc7	G	T	3: 158,318,436	N107K	probably damaging	Het
Lypd8	T	C	11: 58,386,760	S123P	probably damaging	Het
Man2a2	T	C	7: 80,352,981	D1084G	probably damaging	Het
Man2b2	A	G	5: 36,807,175	S1000P	probably benign	Het
Ms4a7	C	T	19: 11,322,414	C71Y	probably benign	Het
Mtus1	A	G	8: 41,084,578	S34P	probably benign	Het
Myo3b	A	G	2: 70,234,441	N406S	probably benign	Het
Nbr1	A	T	11: 101,572,464	M586L	probably benign	Het
Nfatc1	C	T	18: 80,649,855	R677H	probably benign	Het
Nlrc3	A	C	16: 3,964,035	S503R	probably damaging	Het
Nlrp9c	A	T	7: 26,365,000	F968I	probably benign	Het
Olfr340	A	T	2: 36,453,443	N286I	probably damaging	Het
Olfr881	G	A	9: 37,993,011	C168Y	probably damaging	Het
Olfr951	A	G	9: 39,393,961	N57D	probably benign	Het
Onecut1	A	T	9: 74,863,332	T346S	probably damaging	Het
Pclo	A	T	5: 14,680,952	K3156M	unknown	Het
Pigo	C	T	4: 43,024,562		probably null	Het
Plcb4	T	C	2: 135,967,152	F580S	probably damaging	Het
Plekhm2	G	T	4: 141,628,100	P879H	probably damaging	Het
Ppm1e	T	A	11: 87,230,890	Y747F	probably benign	Het
Ppwd1	A	G	13: 104,225,444	F69L	possibly damaging	Het
Prss27	C	A	17: 24,038,313	Q3K	possibly damaging	Het
Prss29	T	A	17: 25,321,046	N139K	possibly damaging	Het
Qrich2	T	A	11: 116,448,365	T1777S	probably damaging	Het
Rbp3	A	T	14: 33,956,627	H844L	possibly damaging	Het
Rubcnl	G	A	14: 75,032,031	C43Y	possibly damaging	Het
Sec14l5	A	G	16: 5,167,140		probably null	Het
Sepsecs	A	T	5: 52,644,014	N435K	probably damaging	Het
Sfrp1	A	G	8: 23,446,210	K223E	probably benign	Het
Sh3tc2	G	A	18: 61,973,431		probably null	Het
Slc35e2	C	T	4: 155,610,026	P10L	probably benign	Het
Tmprss7	A	G	16: 45,656,448	F817S	probably damaging	Het
Tril	T	C	6: 53,819,647	N197D	probably damaging	Het
Tspan18	T	C	2: 93,209,862	T183A	probably benign	Het
Uroc1	A	T	6: 90,338,604	M156L	probably benign	Het
Wnt16	T	C	6: 22,291,161	V196A	probably benign	Het
Xpnpep1	A	G	19: 52,995,519	Y592H	probably benign	Het
Zfp553	T	C	7: 127,237,030	S586P	probably benign	Het
Zfp619	C	T	7: 39,535,728	A394V	unknown	Het
Zfp985	A	G	4: 147,583,245	Y190C	probably benign	Het
Zmynd10	T	A	9: 107,550,337	D309E	probably benign	Het
Zmynd15	T	C	11: 70,461,820	L73P	probably damaging	Het

Other mutations in Cenpf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00778:Cenpf	APN	1	189654912	missense	probably benign	0.01
IGL01154:Cenpf	APN	1	189680333	missense	probably benign	0.19
IGL01434:Cenpf	APN	1	189657868	nonsense	probably null
IGL01461:Cenpf	APN	1	189657096	missense	probably damaging	1.00
IGL01615:Cenpf	APN	1	189653184	missense	possibly damaging	0.68
IGL01720:Cenpf	APN	1	189682386	missense	probably benign	0.05
IGL01720:Cenpf	APN	1	189651215	missense	probably damaging	0.99
IGL01803:Cenpf	APN	1	189654771	nonsense	probably null
IGL02152:Cenpf	APN	1	189649012	missense	probably benign
IGL02222:Cenpf	APN	1	189654444	missense	probably benign
IGL02338:Cenpf	APN	1	189680418	missense	probably damaging	1.00
IGL02580:Cenpf	APN	1	189657441	missense	probably benign	0.20
IGL02629:Cenpf	APN	1	189652334	missense	probably damaging	1.00
IGL02650:Cenpf	APN	1	189652473	missense	possibly damaging	0.91
IGL02660:Cenpf	APN	1	189654782	missense	probably damaging	1.00
IGL02703:Cenpf	APN	1	189659758	missense	probably benign	0.14
IGL02809:Cenpf	APN	1	189682358	splice site	probably benign
IGL02851:Cenpf	APN	1	189658030	missense	probably damaging	1.00
IGL02903:Cenpf	APN	1	189646876	missense	probably damaging	0.99
IGL03126:Cenpf	APN	1	189659010	missense	probably damaging	1.00
IGL03235:Cenpf	APN	1	189683927	missense	probably damaging	1.00
IGL03336:Cenpf	APN	1	189652647	missense	probably damaging	0.99
IGL03402:Cenpf	APN	1	189655076	missense	probably damaging	1.00
IGL02799:Cenpf	UTSW	1	189659652	missense	probably damaging	1.00
R0011:Cenpf	UTSW	1	189650706	missense	probably benign	0.05
R0129:Cenpf	UTSW	1	189659650	missense	probably benign	0.26
R0157:Cenpf	UTSW	1	189652359	missense	probably benign	0.07
R0270:Cenpf	UTSW	1	189650714	missense	probably benign	0.01
R0607:Cenpf	UTSW	1	189682463	splice site	probably null
R0621:Cenpf	UTSW	1	189672628	missense	probably benign
R0639:Cenpf	UTSW	1	189658062	missense	probably benign	0.01
R0653:Cenpf	UTSW	1	189659986	missense	probably damaging	1.00
R0718:Cenpf	UTSW	1	189653984	missense	probably damaging	1.00
R1157:Cenpf	UTSW	1	189658453	missense	probably benign	0.20
R1331:Cenpf	UTSW	1	189642801	missense	probably damaging	0.99
R1463:Cenpf	UTSW	1	189654739	missense	probably damaging	0.97
R1514:Cenpf	UTSW	1	189679141	missense	possibly damaging	0.67
R1529:Cenpf	UTSW	1	189660038	missense	probably benign	0.00
R1574:Cenpf	UTSW	1	189652713	missense	probably damaging	1.00
R1574:Cenpf	UTSW	1	189652713	missense	probably damaging	1.00
R1662:Cenpf	UTSW	1	189657771	missense	probably damaging	0.99
R1671:Cenpf	UTSW	1	189679144	splice site	probably null
R1725:Cenpf	UTSW	1	189680479	missense	probably damaging	0.99
R1743:Cenpf	UTSW	1	189654263	missense	probably benign	0.19
R1874:Cenpf	UTSW	1	189683816	missense	probably damaging	1.00
R1884:Cenpf	UTSW	1	189646849	missense	probably benign
R1980:Cenpf	UTSW	1	189653915	missense	probably benign	0.04
R2074:Cenpf	UTSW	1	189656901	missense	probably damaging	1.00
R2096:Cenpf	UTSW	1	189653459	missense	possibly damaging	0.95
R2109:Cenpf	UTSW	1	189679067	missense	probably damaging	0.99
R2113:Cenpf	UTSW	1	189679102	missense	probably damaging	0.96
R2134:Cenpf	UTSW	1	189658642	missense	probably benign	0.03
R2209:Cenpf	UTSW	1	189652598	missense	probably benign	0.04
R2875:Cenpf	UTSW	1	189658644	missense	probably benign	0.11
R2876:Cenpf	UTSW	1	189658644	missense	probably benign	0.11
R3433:Cenpf	UTSW	1	189659949	missense	probably damaging	0.99
R3709:Cenpf	UTSW	1	189648812	missense	possibly damaging	0.72
R3786:Cenpf	UTSW	1	189658337	missense	probably damaging	1.00
R4014:Cenpf	UTSW	1	189653159	missense	probably benign	0.01
R4108:Cenpf	UTSW	1	189683868	missense	probably damaging	1.00
R4119:Cenpf	UTSW	1	189653045	missense	probably benign	0.01
R4177:Cenpf	UTSW	1	189668619	missense	possibly damaging	0.95
R4422:Cenpf	UTSW	1	189658350	missense	probably damaging	1.00
R4546:Cenpf	UTSW	1	189654650	missense	probably damaging	1.00
R4592:Cenpf	UTSW	1	189679033	missense	probably damaging	1.00
R4643:Cenpf	UTSW	1	189659589	missense	probably benign	0.00
R4650:Cenpf	UTSW	1	189660038	missense	probably benign	0.00
R4801:Cenpf	UTSW	1	189651220	missense	probably damaging	1.00
R4802:Cenpf	UTSW	1	189651220	missense	probably damaging	1.00
R4817:Cenpf	UTSW	1	189682369	missense	possibly damaging	0.93
R4871:Cenpf	UTSW	1	189658531	missense	probably damaging	1.00
R5037:Cenpf	UTSW	1	189683846	missense	probably damaging	1.00
R5106:Cenpf	UTSW	1	189683808	missense	probably benign	0.00
R5208:Cenpf	UTSW	1	189671046	critical splice donor site	probably null
R5213:Cenpf	UTSW	1	189654980	missense	probably benign	0.04
R5237:Cenpf	UTSW	1	189659533	missense	probably benign	0.28
R5255:Cenpf	UTSW	1	189672627	missense	possibly damaging	0.49
R5378:Cenpf	UTSW	1	189653466	missense	possibly damaging	0.95
R5510:Cenpf	UTSW	1	189682903	missense	probably benign	0.14
R5616:Cenpf	UTSW	1	189657286	missense	probably damaging	1.00
R5652:Cenpf	UTSW	1	189657082	missense	probably damaging	0.99
R5735:Cenpf	UTSW	1	189654363	missense	probably benign	0.10
R5841:Cenpf	UTSW	1	189657444	missense	possibly damaging	0.90
R5943:Cenpf	UTSW	1	189659969	missense	possibly damaging	0.75
R6082:Cenpf	UTSW	1	189658104	missense	probably benign	0.11
R6108:Cenpf	UTSW	1	189662013	missense	probably benign	0.03
R6269:Cenpf	UTSW	1	189659920	missense	probably benign	0.37
R6284:Cenpf	UTSW	1	189652742	missense	probably damaging	1.00
R6425:Cenpf	UTSW	1	189659898	missense	probably benign	0.09
R6587:Cenpf	UTSW	1	189658374	missense	probably damaging	1.00
R6747:Cenpf	UTSW	1	189652854	missense	probably benign	0.15
R6811:Cenpf	UTSW	1	189654542	missense	probably benign	0.06
R6834:Cenpf	UTSW	1	189659446	missense	probably damaging	1.00
R6951:Cenpf	UTSW	1	189653792	missense	probably damaging	1.00
R7095:Cenpf	UTSW	1	189659176	missense	probably benign	0.01
R7128:Cenpf	UTSW	1	189684991	missense	probably damaging	1.00
R7185:Cenpf	UTSW	1	189653489	missense	probably damaging	1.00
R7292:Cenpf	UTSW	1	189650694	missense	probably damaging	1.00
R7353:Cenpf	UTSW	1	189654138	nonsense	probably null
R7402:Cenpf	UTSW	1	189659378	nonsense	probably null
R7460:Cenpf	UTSW	1	189654050	missense	probably damaging	0.97
R7484:Cenpf	UTSW	1	189656821	missense	probably damaging	1.00
R7574:Cenpf	UTSW	1	189658667	missense	probably damaging	1.00
R7691:Cenpf	UTSW	1	189658207	nonsense	probably null
R7698:Cenpf	UTSW	1	189662072	missense	probably benign	0.01
RF006:Cenpf	UTSW	1	189657386	missense	probably damaging	1.00
X0025:Cenpf	UTSW	1	189653874	missense	possibly damaging	0.79
X0066:Cenpf	UTSW	1	189657929	missense	probably benign	0.23
Z1088:Cenpf	UTSW	1	189652931	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTCCCTGTAGTCAAGACCATG -3'
(R):5'- GCCCTCACTCAAGAAGTAGAAG -3'

Sequencing Primer
(F):5'- GTCCCTGTAGTCAAGACCATGTAAAC -3'
(R):5'- CTCACTCAAGAAGTAGAAGCTGGC -3'

Posted On

2016-10-06