Incidental Mutation 'R5468:Uroc1'
ID433334
Institutional Source Beutler Lab
Gene Symbol Uroc1
Ensembl Gene ENSMUSG00000034456
Gene Nameurocanase domain containing 1
Synonyms
MMRRC Submission 043029-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5468 (G1)
Quality Score201
Status Not validated
Chromosome6
Chromosomal Location90333284-90364551 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 90338604 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 156 (M156L)
Ref Sequence ENSEMBL: ENSMUSP00000127114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046128] [ENSMUST00000164761]
Predicted Effect probably benign
Transcript: ENSMUST00000046128
AA Change: M156L

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000040424
Gene: ENSMUSG00000034456
AA Change: M156L

DomainStartEndE-ValueType
Pfam:Urocanase 84 662 2.7e-231 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164761
AA Change: M156L

PolyPhen 2 Score 0.446 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000127114
Gene: ENSMUSG00000034456
AA Change: M156L

DomainStartEndE-ValueType
Pfam:Urocanase 85 316 1.4e-102 PFAM
Pfam:Urocanase 319 683 8.7e-144 PFAM
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme involved in histidine catabolism, metabolizing urocanic acid to formiminoglutamic acid. The gene product is known to protect the skin from ultra violet rays and is contained in human sweat. Deficiency of this gene product in the liver is an apparent cause of mental retardation. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik C T 7: 44,360,235 R181Q probably damaging Het
Abca13 T A 11: 9,294,062 L1975Q probably damaging Het
Acp2 T A 2: 91,206,098 I180N probably benign Het
Adam12 T C 7: 133,975,473 D221G probably damaging Het
Adamts4 A G 1: 171,252,609 T244A probably benign Het
Adrb2 A T 18: 62,179,625 I43N probably damaging Het
Anxa1 A T 19: 20,378,483 Y207N probably damaging Het
Apba2 T C 7: 64,745,762 L662P probably damaging Het
Arhgap18 T A 10: 26,912,671 I593K probably damaging Het
Arsj T C 3: 126,438,388 V261A possibly damaging Het
Atp7b A T 8: 22,059,970 probably null Het
C2cd2 C T 16: 97,868,591 probably null Het
C530008M17Rik A T 5: 76,840,763 probably benign Het
Cenpf A T 1: 189,652,371 S2571T probably damaging Het
Cep162 A C 9: 87,227,237 L438V probably benign Het
Cfap74 A T 4: 155,426,041 N361I probably benign Het
Cntn5 A G 9: 9,743,628 I548T probably damaging Het
Dglucy A G 12: 100,850,335 N382S probably benign Het
Dnah10 C A 5: 124,830,493 N4306K probably damaging Het
Fam181a A T 12: 103,316,678 M281L probably benign Het
Fam186b A G 15: 99,278,870 I713T possibly damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fry A T 5: 150,399,588 Y1068F probably benign Het
Fubp3 A G 2: 31,603,235 I231V probably benign Het
Gbf1 A G 19: 46,284,296 D1681G possibly damaging Het
Gm10999 G A 8: 129,131,649 P5S probably damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Impg1 T C 9: 80,465,265 I9V probably benign Het
Lama4 A G 10: 39,072,682 probably null Het
Lamc1 A G 1: 153,233,564 S1161P probably damaging Het
Lipm T A 19: 34,109,554 probably null Het
Lrrc7 G T 3: 158,318,436 N107K probably damaging Het
Lypd8 T C 11: 58,386,760 S123P probably damaging Het
Man2a2 T C 7: 80,352,981 D1084G probably damaging Het
Man2b2 A G 5: 36,807,175 S1000P probably benign Het
Ms4a7 C T 19: 11,322,414 C71Y probably benign Het
Mtus1 A G 8: 41,084,578 S34P probably benign Het
Myo3b A G 2: 70,234,441 N406S probably benign Het
Nbr1 A T 11: 101,572,464 M586L probably benign Het
Nfatc1 C T 18: 80,649,855 R677H probably benign Het
Nlrc3 A C 16: 3,964,035 S503R probably damaging Het
Nlrp9c A T 7: 26,365,000 F968I probably benign Het
Olfr340 A T 2: 36,453,443 N286I probably damaging Het
Olfr881 G A 9: 37,993,011 C168Y probably damaging Het
Olfr951 A G 9: 39,393,961 N57D probably benign Het
Onecut1 A T 9: 74,863,332 T346S probably damaging Het
Pclo A T 5: 14,680,952 K3156M unknown Het
Pigo C T 4: 43,024,562 probably null Het
Plcb4 T C 2: 135,967,152 F580S probably damaging Het
Plekhm2 G T 4: 141,628,100 P879H probably damaging Het
Ppm1e T A 11: 87,230,890 Y747F probably benign Het
Ppwd1 A G 13: 104,225,444 F69L possibly damaging Het
Prss27 C A 17: 24,038,313 Q3K possibly damaging Het
Prss29 T A 17: 25,321,046 N139K possibly damaging Het
Qrich2 T A 11: 116,448,365 T1777S probably damaging Het
Rbp3 A T 14: 33,956,627 H844L possibly damaging Het
Rubcnl G A 14: 75,032,031 C43Y possibly damaging Het
Sec14l5 A G 16: 5,167,140 probably null Het
Sepsecs A T 5: 52,644,014 N435K probably damaging Het
Sfrp1 A G 8: 23,446,210 K223E probably benign Het
Sh3tc2 G A 18: 61,973,431 probably null Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Tmprss7 A G 16: 45,656,448 F817S probably damaging Het
Tril T C 6: 53,819,647 N197D probably damaging Het
Tspan18 T C 2: 93,209,862 T183A probably benign Het
Wnt16 T C 6: 22,291,161 V196A probably benign Het
Xpnpep1 A G 19: 52,995,519 Y592H probably benign Het
Zfp553 T C 7: 127,237,030 S586P probably benign Het
Zfp619 C T 7: 39,535,728 A394V unknown Het
Zfp985 A G 4: 147,583,245 Y190C probably benign Het
Zmynd10 T A 9: 107,550,337 D309E probably benign Het
Zmynd15 T C 11: 70,461,820 L73P probably damaging Het
Other mutations in Uroc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Uroc1 APN 6 90338828 missense probably benign
IGL01015:Uroc1 APN 6 90358901 splice site probably benign
IGL01386:Uroc1 APN 6 90346765 missense probably damaging 0.99
IGL01449:Uroc1 APN 6 90338653 missense probably damaging 1.00
IGL01514:Uroc1 APN 6 90363100 splice site probably benign
IGL02060:Uroc1 APN 6 90338255 missense probably benign 0.03
IGL02247:Uroc1 APN 6 90347928 missense probably benign 0.00
IGL02256:Uroc1 APN 6 90346687 missense possibly damaging 0.83
IGL02886:Uroc1 APN 6 90346829 splice site probably benign
IGL03087:Uroc1 APN 6 90363103 splice site probably benign
PIT4651001:Uroc1 UTSW 6 90363113 nonsense probably null
R0034:Uroc1 UTSW 6 90345310 missense probably damaging 1.00
R0245:Uroc1 UTSW 6 90344197 missense probably damaging 1.00
R0402:Uroc1 UTSW 6 90347302 missense probably damaging 1.00
R0570:Uroc1 UTSW 6 90338564 missense possibly damaging 0.90
R0729:Uroc1 UTSW 6 90336955 missense probably damaging 1.00
R1471:Uroc1 UTSW 6 90344171 missense probably damaging 1.00
R1782:Uroc1 UTSW 6 90336919 missense probably damaging 1.00
R1866:Uroc1 UTSW 6 90361524 missense probably benign 0.03
R1983:Uroc1 UTSW 6 90345369 missense probably damaging 1.00
R2086:Uroc1 UTSW 6 90344114 missense probably damaging 1.00
R2321:Uroc1 UTSW 6 90347247 missense possibly damaging 0.94
R3720:Uroc1 UTSW 6 90346355 missense probably damaging 1.00
R3874:Uroc1 UTSW 6 90361512 nonsense probably null
R4628:Uroc1 UTSW 6 90355328 missense probably damaging 0.99
R4810:Uroc1 UTSW 6 90363153 missense probably damaging 1.00
R4820:Uroc1 UTSW 6 90357618 critical splice donor site probably null
R4838:Uroc1 UTSW 6 90349192 missense possibly damaging 0.90
R4880:Uroc1 UTSW 6 90357537 missense probably damaging 1.00
R4964:Uroc1 UTSW 6 90345394 missense probably damaging 0.98
R4966:Uroc1 UTSW 6 90345394 missense probably damaging 0.98
R5592:Uroc1 UTSW 6 90355344 missense probably damaging 0.99
R5698:Uroc1 UTSW 6 90347320 missense probably damaging 1.00
R5789:Uroc1 UTSW 6 90344197 missense probably damaging 1.00
R5853:Uroc1 UTSW 6 90346756 missense probably damaging 0.99
R6063:Uroc1 UTSW 6 90347928 missense probably benign 0.37
R6883:Uroc1 UTSW 6 90338592 nonsense probably null
R7374:Uroc1 UTSW 6 90338833 missense probably damaging 1.00
R7394:Uroc1 UTSW 6 90345333 missense probably damaging 1.00
R7427:Uroc1 UTSW 6 90346362 missense possibly damaging 0.56
R8376:Uroc1 UTSW 6 90337715 missense probably damaging 0.99
X0021:Uroc1 UTSW 6 90344150 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- ATTAGGTGGACCGACAGAACC -3'
(R):5'- TCATACTCTGTCCTGGAGGAGTAG -3'

Sequencing Primer
(F):5'- CTGCAAGAATCCCTGGATCTAGGTG -3'
(R):5'- GGAGTAGTTGGGAATGACCTG -3'
Posted On2016-10-06