Incidental Mutation 'R5468:Nbr1'
ID433366
Institutional Source Beutler Lab
Gene Symbol Nbr1
Ensembl Gene ENSMUSG00000017119
Gene Nameneighbor of Brca1 gene 1
Synonyms
MMRRC Submission 043029-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5468 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location101552149-101581951 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101572464 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 586 (M586L)
Ref Sequence ENSEMBL: ENSMUSP00000133619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071537] [ENSMUST00000103098] [ENSMUST00000103099] [ENSMUST00000107208] [ENSMUST00000107212] [ENSMUST00000107213] [ENSMUST00000107218] [ENSMUST00000123558]
Predicted Effect probably benign
Transcript: ENSMUST00000071537
AA Change: M586L

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000071467
Gene: ENSMUSG00000017119
AA Change: M586L

DomainStartEndE-ValueType
PB1 4 86 2.05e-8 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
Pfam:N_BRCA1_IG 378 479 7.1e-34 PFAM
low complexity region 507 518 N/A INTRINSIC
coiled coil region 714 744 N/A INTRINSIC
PDB:2MJ5|B 935 981 2e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000103098
AA Change: M586L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000099387
Gene: ENSMUSG00000017119
AA Change: M586L

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 5e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 714 744 N/A INTRINSIC
PDB:2MJ5|B 935 981 2e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000103099
AA Change: M586L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000099388
Gene: ENSMUSG00000017119
AA Change: M586L

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 5e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 714 744 N/A INTRINSIC
PDB:2MJ5|B 935 981 2e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000107208
AA Change: M586L

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000102826
Gene: ENSMUSG00000017119
AA Change: M586L

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 1e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 714 744 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107212
AA Change: M586L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000102830
Gene: ENSMUSG00000017119
AA Change: M586L

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 3e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 689 719 N/A INTRINSIC
PDB:2MJ5|B 910 956 2e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000107213
SMART Domains Protein: ENSMUSP00000102831
Gene: ENSMUSG00000017119

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 2e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 677 707 N/A INTRINSIC
PDB:2MJ5|B 898 944 2e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000107218
AA Change: M586L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000102836
Gene: ENSMUSG00000017119
AA Change: M586L

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 5e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 714 744 N/A INTRINSIC
PDB:2MJ5|B 935 981 2e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000123558
AA Change: M586L

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000133619
Gene: ENSMUSG00000017119
AA Change: M586L

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 2e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 714 744 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144517
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148805
Predicted Effect unknown
Transcript: ENSMUST00000149019
AA Change: M345L
SMART Domains Protein: ENSMUSP00000119900
Gene: ENSMUSG00000017119
AA Change: M345L

DomainStartEndE-ValueType
coiled coil region 50 89 N/A INTRINSIC
Pfam:N_BRCA1_IG 138 239 2.3e-34 PFAM
low complexity region 267 278 N/A INTRINSIC
coiled coil region 473 500 N/A INTRINSIC
PDB:2MJ5|B 659 705 1e-24 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174013
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was originally identified as an ovarian tumor antigen monitored in ovarian cancer. The encoded protein contains a B-box/coiled-coil motif, which is present in many genes with transformation potential. It functions as a specific autophagy receptor for the selective autophagic degradation of peroxisomes by forming intracellular inclusions with ubiquitylated autophagic substrates. This gene is located on a region of chromosome 17q21.1 that is in close proximity to the BRCA1 tumor suppressor gene. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous mice of the genetic truncation allele had an age-dependent increase in bone mass and bone mineral density. Mice homozygous for a floxed allele activated in T cells exhibit decreased ovalbumin-induced inflammation and defective Th2 polarization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik C T 7: 44,360,235 R181Q probably damaging Het
Abca13 T A 11: 9,294,062 L1975Q probably damaging Het
Acp2 T A 2: 91,206,098 I180N probably benign Het
Adam12 T C 7: 133,975,473 D221G probably damaging Het
Adamts4 A G 1: 171,252,609 T244A probably benign Het
Adrb2 A T 18: 62,179,625 I43N probably damaging Het
Anxa1 A T 19: 20,378,483 Y207N probably damaging Het
Apba2 T C 7: 64,745,762 L662P probably damaging Het
Arhgap18 T A 10: 26,912,671 I593K probably damaging Het
Arsj T C 3: 126,438,388 V261A possibly damaging Het
Atp7b A T 8: 22,059,970 probably null Het
C2cd2 C T 16: 97,868,591 probably null Het
C530008M17Rik A T 5: 76,840,763 probably benign Het
Cenpf A T 1: 189,652,371 S2571T probably damaging Het
Cep162 A C 9: 87,227,237 L438V probably benign Het
Cfap74 A T 4: 155,426,041 N361I probably benign Het
Cntn5 A G 9: 9,743,628 I548T probably damaging Het
Dglucy A G 12: 100,850,335 N382S probably benign Het
Dnah10 C A 5: 124,830,493 N4306K probably damaging Het
Fam181a A T 12: 103,316,678 M281L probably benign Het
Fam186b A G 15: 99,278,870 I713T possibly damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fry A T 5: 150,399,588 Y1068F probably benign Het
Fubp3 A G 2: 31,603,235 I231V probably benign Het
Gbf1 A G 19: 46,284,296 D1681G possibly damaging Het
Gm10999 G A 8: 129,131,649 P5S probably damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Impg1 T C 9: 80,465,265 I9V probably benign Het
Lama4 A G 10: 39,072,682 probably null Het
Lamc1 A G 1: 153,233,564 S1161P probably damaging Het
Lipm T A 19: 34,109,554 probably null Het
Lrrc7 G T 3: 158,318,436 N107K probably damaging Het
Lypd8 T C 11: 58,386,760 S123P probably damaging Het
Man2a2 T C 7: 80,352,981 D1084G probably damaging Het
Man2b2 A G 5: 36,807,175 S1000P probably benign Het
Ms4a7 C T 19: 11,322,414 C71Y probably benign Het
Mtus1 A G 8: 41,084,578 S34P probably benign Het
Myo3b A G 2: 70,234,441 N406S probably benign Het
Nfatc1 C T 18: 80,649,855 R677H probably benign Het
Nlrc3 A C 16: 3,964,035 S503R probably damaging Het
Nlrp9c A T 7: 26,365,000 F968I probably benign Het
Olfr340 A T 2: 36,453,443 N286I probably damaging Het
Olfr881 G A 9: 37,993,011 C168Y probably damaging Het
Olfr951 A G 9: 39,393,961 N57D probably benign Het
Onecut1 A T 9: 74,863,332 T346S probably damaging Het
Pclo A T 5: 14,680,952 K3156M unknown Het
Pigo C T 4: 43,024,562 probably null Het
Plcb4 T C 2: 135,967,152 F580S probably damaging Het
Plekhm2 G T 4: 141,628,100 P879H probably damaging Het
Ppm1e T A 11: 87,230,890 Y747F probably benign Het
Ppwd1 A G 13: 104,225,444 F69L possibly damaging Het
Prss27 C A 17: 24,038,313 Q3K possibly damaging Het
Prss29 T A 17: 25,321,046 N139K possibly damaging Het
Qrich2 T A 11: 116,448,365 T1777S probably damaging Het
Rbp3 A T 14: 33,956,627 H844L possibly damaging Het
Rubcnl G A 14: 75,032,031 C43Y possibly damaging Het
Sec14l5 A G 16: 5,167,140 probably null Het
Sepsecs A T 5: 52,644,014 N435K probably damaging Het
Sfrp1 A G 8: 23,446,210 K223E probably benign Het
Sh3tc2 G A 18: 61,973,431 probably null Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Tmprss7 A G 16: 45,656,448 F817S probably damaging Het
Tril T C 6: 53,819,647 N197D probably damaging Het
Tspan18 T C 2: 93,209,862 T183A probably benign Het
Uroc1 A T 6: 90,338,604 M156L probably benign Het
Wnt16 T C 6: 22,291,161 V196A probably benign Het
Xpnpep1 A G 19: 52,995,519 Y592H probably benign Het
Zfp553 T C 7: 127,237,030 S586P probably benign Het
Zfp619 C T 7: 39,535,728 A394V unknown Het
Zfp985 A G 4: 147,583,245 Y190C probably benign Het
Zmynd10 T A 9: 107,550,337 D309E probably benign Het
Zmynd15 T C 11: 70,461,820 L73P probably damaging Het
Other mutations in Nbr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02187:Nbr1 APN 11 101569359 missense possibly damaging 0.91
IGL02192:Nbr1 APN 11 101569591 missense probably damaging 1.00
IGL02259:Nbr1 APN 11 101577990 missense probably damaging 0.99
IGL02951:Nbr1 APN 11 101571979 critical splice donor site probably null
IGL02994:Nbr1 APN 11 101556227 missense probably damaging 1.00
R0087:Nbr1 UTSW 11 101564693 missense probably benign 0.16
R0630:Nbr1 UTSW 11 101567087 unclassified probably benign
R0723:Nbr1 UTSW 11 101576319 nonsense probably null
R0733:Nbr1 UTSW 11 101576371 missense probably benign 0.00
R1482:Nbr1 UTSW 11 101572841 missense probably benign 0.34
R1567:Nbr1 UTSW 11 101575211 missense probably damaging 0.98
R1570:Nbr1 UTSW 11 101564830 unclassified probably benign
R1668:Nbr1 UTSW 11 101569766 missense probably benign 0.00
R1759:Nbr1 UTSW 11 101559543 missense probably damaging 1.00
R1903:Nbr1 UTSW 11 101575152 missense probably damaging 0.98
R1927:Nbr1 UTSW 11 101567214 missense possibly damaging 0.78
R2131:Nbr1 UTSW 11 101566191 unclassified probably null
R2211:Nbr1 UTSW 11 101567264 critical splice donor site probably null
R2255:Nbr1 UTSW 11 101572817 missense possibly damaging 0.80
R4270:Nbr1 UTSW 11 101567222 missense possibly damaging 0.87
R4271:Nbr1 UTSW 11 101567222 missense possibly damaging 0.87
R4710:Nbr1 UTSW 11 101575275 missense probably damaging 1.00
R4947:Nbr1 UTSW 11 101575077 missense probably benign 0.06
R5554:Nbr1 UTSW 11 101564807 missense probably benign 0.34
R5771:Nbr1 UTSW 11 101559538 missense probably damaging 1.00
R6119:Nbr1 UTSW 11 101567112 unclassified probably null
R6400:Nbr1 UTSW 11 101565774 missense probably damaging 1.00
R6603:Nbr1 UTSW 11 101556105 unclassified probably benign
R6943:Nbr1 UTSW 11 101577951 missense probably damaging 1.00
R7347:Nbr1 UTSW 11 101569321 nonsense probably null
R7472:Nbr1 UTSW 11 101571939 missense probably damaging 1.00
R7501:Nbr1 UTSW 11 101566200 missense probably damaging 1.00
R7709:Nbr1 UTSW 11 101556241 missense probably damaging 1.00
R7744:Nbr1 UTSW 11 101569384 missense probably damaging 1.00
R7795:Nbr1 UTSW 11 101569328 missense probably damaging 1.00
X0019:Nbr1 UTSW 11 101567124 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TCAGCTTTGATGAGCCAGAGC -3'
(R):5'- CATCGATTTGCTGAGGTAGAGG -3'

Sequencing Primer
(F):5'- CTAGTTGCGTTCCTGGTGAGC -3'
(R):5'- ATCGATTTGCTGAGGTAGAGGTAATG -3'
Posted On2016-10-06