Incidental Mutation 'R5468:Ms4a7'
ID 433385
Institutional Source Beutler Lab
Gene Symbol Ms4a7
Ensembl Gene ENSMUSG00000024672
Gene Name membrane-spanning 4-domains, subfamily A, member 7
Synonyms 9130422I10Rik, CD20l4, CFFMA, A430103C15Rik
MMRRC Submission 043029-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock # R5468 (G1)
Quality Score 197
Status Not validated
Chromosome 19
Chromosomal Location 11321039-11336146 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 11322414 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 71 (C71Y)
Ref Sequence ENSEMBL: ENSMUSP00000124911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025574] [ENSMUST00000056035] [ENSMUST00000067532] [ENSMUST00000159269]
AlphaFold E9Q9V5
Predicted Effect probably benign
Transcript: ENSMUST00000025574
SMART Domains Protein: ENSMUSP00000025574
Gene: ENSMUSG00000024672

DomainStartEndE-ValueType
Pfam:CD20 80 237 4.6e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056035
SMART Domains Protein: ENSMUSP00000054830
Gene: ENSMUSG00000024672

DomainStartEndE-ValueType
transmembrane domain 53 72 N/A INTRINSIC
Pfam:CD20 92 185 3.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067532
SMART Domains Protein: ENSMUSP00000064534
Gene: ENSMUSG00000024672

DomainStartEndE-ValueType
Pfam:CD20 47 204 4.9e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159269
AA Change: C71Y

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124911
Gene: ENSMUSG00000024672
AA Change: C71Y

DomainStartEndE-ValueType
Pfam:CD20 1 100 1.4e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162785
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-spanning 4A gene family, members of which are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns in hematopoietic cells and nonlymphoid tissues. This family member is associated with mature cellular function in the monocytic lineage, and it may be a component of a receptor complex involved in signal transduction. This gene is localized to 11q12, in a cluster of other family members. At least four alternatively spliced transcript variants encoding two distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik C T 7: 44,360,235 R181Q probably damaging Het
Abca13 T A 11: 9,294,062 L1975Q probably damaging Het
Acp2 T A 2: 91,206,098 I180N probably benign Het
Adam12 T C 7: 133,975,473 D221G probably damaging Het
Adamts4 A G 1: 171,252,609 T244A probably benign Het
Adrb2 A T 18: 62,179,625 I43N probably damaging Het
Anxa1 A T 19: 20,378,483 Y207N probably damaging Het
Apba2 T C 7: 64,745,762 L662P probably damaging Het
Arhgap18 T A 10: 26,912,671 I593K probably damaging Het
Arsj T C 3: 126,438,388 V261A possibly damaging Het
Atp7b A T 8: 22,059,970 probably null Het
C2cd2 C T 16: 97,868,591 probably null Het
C530008M17Rik A T 5: 76,840,763 probably benign Het
Cenpf A T 1: 189,652,371 S2571T probably damaging Het
Cep162 A C 9: 87,227,237 L438V probably benign Het
Cfap74 A T 4: 155,426,041 N361I probably benign Het
Cntn5 A G 9: 9,743,628 I548T probably damaging Het
Dglucy A G 12: 100,850,335 N382S probably benign Het
Dnah10 C A 5: 124,830,493 N4306K probably damaging Het
Fam181a A T 12: 103,316,678 M281L probably benign Het
Fam186b A G 15: 99,278,870 I713T possibly damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fry A T 5: 150,399,588 Y1068F probably benign Het
Fubp3 A G 2: 31,603,235 I231V probably benign Het
Gbf1 A G 19: 46,284,296 D1681G possibly damaging Het
Gm10999 G A 8: 129,131,649 P5S probably damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Impg1 T C 9: 80,465,265 I9V probably benign Het
Lama4 A G 10: 39,072,682 probably null Het
Lamc1 A G 1: 153,233,564 S1161P probably damaging Het
Lipm T A 19: 34,109,554 probably null Het
Lrrc7 G T 3: 158,318,436 N107K probably damaging Het
Lypd8 T C 11: 58,386,760 S123P probably damaging Het
Man2a2 T C 7: 80,352,981 D1084G probably damaging Het
Man2b2 A G 5: 36,807,175 S1000P probably benign Het
Mtus1 A G 8: 41,084,578 S34P probably benign Het
Myo3b A G 2: 70,234,441 N406S probably benign Het
Nbr1 A T 11: 101,572,464 M586L probably benign Het
Nfatc1 C T 18: 80,649,855 R677H probably benign Het
Nlrc3 A C 16: 3,964,035 S503R probably damaging Het
Nlrp9c A T 7: 26,365,000 F968I probably benign Het
Olfr340 A T 2: 36,453,443 N286I probably damaging Het
Olfr881 G A 9: 37,993,011 C168Y probably damaging Het
Olfr951 A G 9: 39,393,961 N57D probably benign Het
Onecut1 A T 9: 74,863,332 T346S probably damaging Het
Pclo A T 5: 14,680,952 K3156M unknown Het
Pigo C T 4: 43,024,562 probably null Het
Plcb4 T C 2: 135,967,152 F580S probably damaging Het
Plekhm2 G T 4: 141,628,100 P879H probably damaging Het
Ppm1e T A 11: 87,230,890 Y747F probably benign Het
Ppwd1 A G 13: 104,225,444 F69L possibly damaging Het
Prss27 C A 17: 24,038,313 Q3K possibly damaging Het
Prss29 T A 17: 25,321,046 N139K possibly damaging Het
Qrich2 T A 11: 116,448,365 T1777S probably damaging Het
Rbp3 A T 14: 33,956,627 H844L possibly damaging Het
Rubcnl G A 14: 75,032,031 C43Y possibly damaging Het
Sec14l5 A G 16: 5,167,140 probably null Het
Sepsecs A T 5: 52,644,014 N435K probably damaging Het
Sfrp1 A G 8: 23,446,210 K223E probably benign Het
Sh3tc2 G A 18: 61,973,431 probably null Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Tmprss7 A G 16: 45,656,448 F817S probably damaging Het
Tril T C 6: 53,819,647 N197D probably damaging Het
Tspan18 T C 2: 93,209,862 T183A probably benign Het
Uroc1 A T 6: 90,338,604 M156L probably benign Het
Wnt16 T C 6: 22,291,161 V196A probably benign Het
Xpnpep1 A G 19: 52,995,519 Y592H probably benign Het
Zfp553 T C 7: 127,237,030 S586P probably benign Het
Zfp619 C T 7: 39,535,728 A394V unknown Het
Zfp985 A G 4: 147,583,245 Y190C probably benign Het
Zmynd10 T A 9: 107,550,337 D309E probably benign Het
Zmynd15 T C 11: 70,461,820 L73P probably damaging Het
Other mutations in Ms4a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Ms4a7 APN 19 11322360 missense probably damaging 0.98
IGL01845:Ms4a7 APN 19 11322387 missense possibly damaging 0.86
IGL02409:Ms4a7 APN 19 11324443 nonsense probably null
R1851:Ms4a7 UTSW 19 11324424 missense probably benign 0.08
R5426:Ms4a7 UTSW 19 11325802 splice site probably null
R6267:Ms4a7 UTSW 19 11333295 missense possibly damaging 0.88
R6756:Ms4a7 UTSW 19 11324525 missense possibly damaging 0.93
R6990:Ms4a7 UTSW 19 11333241 missense probably damaging 0.99
R7260:Ms4a7 UTSW 19 11322346 missense probably damaging 1.00
R7272:Ms4a7 UTSW 19 11333278 nonsense probably null
R7397:Ms4a7 UTSW 19 11321552 missense probably benign 0.16
R7678:Ms4a7 UTSW 19 11324504 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTGGGCCTGTATCATTGCAG -3'
(R):5'- GCACTAGGGGTGTTTCTAATAAAGG -3'

Sequencing Primer
(F):5'- GCCTGTATCATTGCAGCTCAGAG -3'
(R):5'- GGGACTTTAAAACTGCTTCTGC -3'
Posted On 2016-10-06