Incidental Mutation 'R5469:Chst10'
ID433389
Institutional Source Beutler Lab
Gene Symbol Chst10
Ensembl Gene ENSMUSG00000026080
Gene Namecarbohydrate sulfotransferase 10
SynonymsST, Hnk-1st
MMRRC Submission 043030-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R5469 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location38863867-38898161 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38865527 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 362 (Y362N)
Ref Sequence ENSEMBL: ENSMUSP00000141295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027249] [ENSMUST00000192948] [ENSMUST00000193441] [ENSMUST00000194361] [ENSMUST00000194657]
Predicted Effect probably damaging
Transcript: ENSMUST00000027249
AA Change: Y366N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027249
Gene: ENSMUSG00000026080
AA Change: Y366N

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
Pfam:Sulfotransfer_2 129 367 7.1e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192948
SMART Domains Protein: ENSMUSP00000141470
Gene: ENSMUSG00000026080

DomainStartEndE-ValueType
Pfam:Sulfotransfer_2 22 238 2.5e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193441
SMART Domains Protein: ENSMUSP00000142028
Gene: ENSMUSG00000026080

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
Pfam:Sulfotransfer_2 129 196 2.1e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000194361
AA Change: Y362N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141295
Gene: ENSMUSG00000026080
AA Change: Y362N

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Pfam:Sulfotransfer_2 125 363 1.3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194657
SMART Domains Protein: ENSMUSP00000141481
Gene: ENSMUSG00000026080

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene transfers sulfate to the C-3 hydroxyl of terminal glucuronic acid of protein- and lipid-linked oligosaccharides. This protein was first identified as a sulfotransferase that acts on the human natural killer-1 (HNK-1) glycan; HNK-1 is a carbohydrate involved in neurodevelopment and synaptic plasticity.[provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous mutation of this gene results in altered synaptic transmission and long term potentiation. Mutant animals exhibit impaired spatial learning and long term memory deficits. Mice homozygous for a different knock-out allele exhibit reduced male and female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Allc A T 12: 28,555,306 N331K probably benign Het
Anapc1 G T 2: 128,675,701 S341* probably null Het
Cacna1e T C 1: 154,443,937 E1339G probably damaging Het
Cacna2d1 T A 5: 16,352,678 I702N probably damaging Het
Casp2 C A 6: 42,269,334 H209N probably benign Het
Casr A G 16: 36,510,030 V314A probably benign Het
Ccne2 A T 4: 11,201,353 R294* probably null Het
Cd180 T A 13: 102,704,834 H129Q probably benign Het
Ctnna1 T A 18: 35,239,520 D509E probably benign Het
Ctsh G T 9: 90,060,511 probably null Het
Dhx29 C T 13: 112,944,539 A369V possibly damaging Het
Enox1 A G 14: 77,592,974 T340A probably benign Het
Fam135b T A 15: 71,446,043 T1357S probably benign Het
Flt3 A T 5: 147,355,083 S544T possibly damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Gsap A T 5: 21,290,544 Y831F possibly damaging Het
Hnrnpr C T 4: 136,319,434 T142M probably damaging Het
Jak3 A G 8: 71,678,773 D94G probably benign Het
Ktn1 A T 14: 47,690,920 E579D probably damaging Het
Lama2 G A 10: 27,041,189 P2247S possibly damaging Het
Lrba C T 3: 86,542,641 S2089F probably damaging Het
Map1b C T 13: 99,429,338 V2292M unknown Het
Mphosph10 A T 7: 64,389,445 probably null Het
Pappa C T 4: 65,205,152 T908M probably benign Het
Pdcd10 T A 3: 75,521,057 K150* probably null Het
Piezo2 A T 18: 63,027,864 I2275N probably damaging Het
Pmvk T C 3: 89,467,682 probably null Het
Pold2 G A 11: 5,873,048 P376S probably damaging Het
Prtg A T 9: 72,891,965 Q759L probably damaging Het
Rad51ap1 C T 6: 126,928,227 S107N probably damaging Het
Rfk T A 19: 17,395,202 N29K probably damaging Het
Ror2 T C 13: 53,117,339 M315V probably benign Het
Rrn3 A G 16: 13,813,100 E600G probably benign Het
Ryk A G 9: 102,906,954 Y593C possibly damaging Het
Slc30a3 T A 5: 31,088,660 D193V probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Srbd1 C A 17: 86,119,942 C421F possibly damaging Het
Sstr5 A C 17: 25,492,069 V62G probably damaging Het
Tfip11 G A 5: 112,334,325 W483* probably null Het
Tlk1 T C 2: 70,721,668 H553R probably benign Het
Tnc T C 4: 64,013,925 probably null Het
Trav12-1 A G 14: 53,538,473 T27A probably damaging Het
Usp9y G A Y: 1,364,714 T1033I probably benign Het
V1ra8 C T 6: 90,203,204 H130Y probably benign Het
Vmn2r77 A T 7: 86,802,063 M386L probably benign Het
Other mutations in Chst10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01947:Chst10 APN 1 38865565 missense probably damaging 1.00
R0142:Chst10 UTSW 1 38871729 missense probably damaging 1.00
R0513:Chst10 UTSW 1 38865763 missense probably damaging 1.00
R1163:Chst10 UTSW 1 38871702 missense probably damaging 1.00
R1464:Chst10 UTSW 1 38865691 missense probably damaging 1.00
R1464:Chst10 UTSW 1 38865691 missense probably damaging 1.00
R2129:Chst10 UTSW 1 38865695 missense probably benign 0.41
R4163:Chst10 UTSW 1 38871823 missense probably benign 0.01
R4712:Chst10 UTSW 1 38865841 missense probably damaging 1.00
R5328:Chst10 UTSW 1 38895962 start gained probably benign
R6311:Chst10 UTSW 1 38868047 missense probably damaging 1.00
R6395:Chst10 UTSW 1 38871689 missense probably damaging 1.00
R7156:Chst10 UTSW 1 38874007 missense probably damaging 0.98
R7706:Chst10 UTSW 1 38866025 missense probably damaging 0.99
R7789:Chst10 UTSW 1 38884451 missense probably benign 0.03
R7941:Chst10 UTSW 1 38871691 missense probably damaging 1.00
R8039:Chst10 UTSW 1 38866031 nonsense probably null
R8252:Chst10 UTSW 1 38884352 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGTCATCAGAGCATCTGTC -3'
(R):5'- TCAAGTACAGTGTGGTCGGAC -3'

Sequencing Primer
(F):5'- GTCATCAGAGCATCTGTCACCTGAG -3'
(R):5'- GACACCATGAGACCCTGGAG -3'
Posted On2016-10-06