Incidental Mutation 'R5469:Pdcd10'
ID433393
Institutional Source Beutler Lab
Gene Symbol Pdcd10
Ensembl Gene ENSMUSG00000027835
Gene Nameprogrammed cell death 10
SynonymsTfa15, TF-1 cell apoptosis related protein-15, 2410003B13Rik, CCM3
MMRRC Submission 043030-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5469 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location75516490-75556856 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 75521057 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 150 (K150*)
Ref Sequence ENSEMBL: ENSMUSP00000125752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029424] [ENSMUST00000161137]
Predicted Effect probably null
Transcript: ENSMUST00000029424
AA Change: K87*
SMART Domains Protein: ENSMUSP00000029424
Gene: ENSMUSG00000027835
AA Change: K87*

DomainStartEndE-ValueType
Pfam:DUF1241 1 99 1.7e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159519
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160196
Predicted Effect probably null
Transcript: ENSMUST00000161137
AA Change: K150*
SMART Domains Protein: ENSMUSP00000125752
Gene: ENSMUSG00000027835
AA Change: K150*

DomainStartEndE-ValueType
Pfam:DUF1241 14 161 1.7e-66 PFAM
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an evolutionarily conserved protein associated with cell apoptosis. The protein interacts with the serine/threonine protein kinase MST4 to modulate the extracellular signal-regulated kinase (ERK) pathway. It also interacts with and is phosphoryated by serine/threonine kinase 25, and is thought to function in a signaling pathway essential for vascular developent. Mutations in this gene are one cause of cerebral cavernous malformations, which are vascular malformations that cause seizures and cerebral hemorrhages. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous knockout is embryonic lethal due to impaired hematopoeisis, vasculogenesis, and abnormal heart morphology. Conditional knockout in myeloids increases degranulation of, and exocytosis by, neutrophils. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Allc A T 12: 28,555,306 N331K probably benign Het
Anapc1 G T 2: 128,675,701 S341* probably null Het
Cacna1e T C 1: 154,443,937 E1339G probably damaging Het
Cacna2d1 T A 5: 16,352,678 I702N probably damaging Het
Casp2 C A 6: 42,269,334 H209N probably benign Het
Casr A G 16: 36,510,030 V314A probably benign Het
Ccne2 A T 4: 11,201,353 R294* probably null Het
Cd180 T A 13: 102,704,834 H129Q probably benign Het
Chst10 A T 1: 38,865,527 Y362N probably damaging Het
Ctnna1 T A 18: 35,239,520 D509E probably benign Het
Ctsh G T 9: 90,060,511 probably null Het
Dhx29 C T 13: 112,944,539 A369V possibly damaging Het
Enox1 A G 14: 77,592,974 T340A probably benign Het
Fam135b T A 15: 71,446,043 T1357S probably benign Het
Flt3 A T 5: 147,355,083 S544T possibly damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Gsap A T 5: 21,290,544 Y831F possibly damaging Het
Hnrnpr C T 4: 136,319,434 T142M probably damaging Het
Jak3 A G 8: 71,678,773 D94G probably benign Het
Ktn1 A T 14: 47,690,920 E579D probably damaging Het
Lama2 G A 10: 27,041,189 P2247S possibly damaging Het
Lrba C T 3: 86,542,641 S2089F probably damaging Het
Map1b C T 13: 99,429,338 V2292M unknown Het
Mphosph10 A T 7: 64,389,445 probably null Het
Pappa C T 4: 65,205,152 T908M probably benign Het
Piezo2 A T 18: 63,027,864 I2275N probably damaging Het
Pmvk T C 3: 89,467,682 probably null Het
Pold2 G A 11: 5,873,048 P376S probably damaging Het
Prtg A T 9: 72,891,965 Q759L probably damaging Het
Rad51ap1 C T 6: 126,928,227 S107N probably damaging Het
Rfk T A 19: 17,395,202 N29K probably damaging Het
Ror2 T C 13: 53,117,339 M315V probably benign Het
Rrn3 A G 16: 13,813,100 E600G probably benign Het
Ryk A G 9: 102,906,954 Y593C possibly damaging Het
Slc30a3 T A 5: 31,088,660 D193V probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Srbd1 C A 17: 86,119,942 C421F possibly damaging Het
Sstr5 A C 17: 25,492,069 V62G probably damaging Het
Tfip11 G A 5: 112,334,325 W483* probably null Het
Tlk1 T C 2: 70,721,668 H553R probably benign Het
Tnc T C 4: 64,013,925 probably null Het
Trav12-1 A G 14: 53,538,473 T27A probably damaging Het
Usp9y G A Y: 1,364,714 T1033I probably benign Het
V1ra8 C T 6: 90,203,204 H130Y probably benign Het
Vmn2r77 A T 7: 86,802,063 M386L probably benign Het
Other mutations in Pdcd10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Pdcd10 APN 3 75541233 missense probably damaging 0.98
IGL01545:Pdcd10 APN 3 75541168 missense possibly damaging 0.57
IGL02179:Pdcd10 APN 3 75527615 missense probably damaging 1.00
IGL02675:Pdcd10 APN 3 75527594 missense probably damaging 1.00
R0299:Pdcd10 UTSW 3 75527651 missense probably damaging 1.00
R0499:Pdcd10 UTSW 3 75527651 missense probably damaging 1.00
R1674:Pdcd10 UTSW 3 75541179 missense probably damaging 0.99
R4197:Pdcd10 UTSW 3 75517592 missense possibly damaging 0.77
R4615:Pdcd10 UTSW 3 75521091 missense probably damaging 1.00
R4908:Pdcd10 UTSW 3 75541246 missense probably damaging 0.98
R6628:Pdcd10 UTSW 3 75521071 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAGTCAAAGGGCAATGGC -3'
(R):5'- GCAAATGAGCACTTTGAGGGTC -3'

Sequencing Primer
(F):5'- TGAATATGGCATGATTTATAGTCCG -3'
(R):5'- GCACTACACTTGGGATGATTGCAC -3'
Posted On2016-10-06