Mutagenetix > Incidental Mutations

Incidental Mutation 'R5469:Gsap'

433400

Institutional Source

Beutler Lab

Gene Symbol

Gsap

Ensembl Gene

ENSMUSG00000039934

Gene Name

gamma-secretase activating protein

Synonyms

A530088I07Rik, Pion

MMRRC Submission

043030-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.104) question?

Stock #

R5469 (G1)

Quality Score

195

Status

Not validated

Chromosome

Chromosomal Location

21186255-21315132 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 21290544 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 831 (Y831F)

Ref Sequence

ENSEMBL: ENSMUSP00000043679 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036031] [ENSMUST00000115245] [ENSMUST00000195969] [ENSMUST00000198014] [ENSMUST00000198930] [ENSMUST00000198937]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000036031
AA Change: Y831F

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000043679
Gene: ENSMUSG00000039934
AA Change: Y831F

Domain	Start	End	E-Value	Type
low complexity region	386	398	N/A	INTRINSIC
Pfam:GSAP-16	646	753	6.8e-43	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000115245

SMART Domains

Protein: ENSMUSP00000110900
Gene: ENSMUSG00000064280

Domain	Start	End	E-Value	Type
coiled coil region	1	33	N/A	INTRINSIC
low complexity region	120	130	N/A	INTRINSIC
coiled coil region	194	320	N/A	INTRINSIC
low complexity region	333	342	N/A	INTRINSIC
coiled coil region	438	477	N/A	INTRINSIC
coiled coil region	549	595	N/A	INTRINSIC
coiled coil region	617	663	N/A	INTRINSIC
coiled coil region	690	720	N/A	INTRINSIC
coiled coil region	770	793	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000195969

Predicted Effect

probably benign
Transcript: ENSMUST00000198014

Predicted Effect

possibly damaging
Transcript: ENSMUST00000198930
AA Change: Y70F

PolyPhen 2 Score 0.538 (Sensitivity: 0.88; Specificity: 0.90)

Predicted Effect

probably benign
Transcript: ENSMUST00000198937

SMART Domains

Protein: ENSMUSP00000142986
Gene: ENSMUSG00000039934

Domain	Start	End	E-Value	Type
low complexity region	355	367	N/A	INTRINSIC
Pfam:GSAP-16	608	722	1.6e-42	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199553

Coding Region Coverage

1x: 98.2%
3x: 97.3%
10x: 95.1%
20x: 90.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Accumulation of neurotoxic amyloid-beta is a major hallmark of Alzheimer disease (AD; MIM 104300). Formation of amyloid-beta is catalyzed by gamma-secretase (see PSEN1; MIM 104311), a protease with numerous substrates. PION, or GSAP, selectively increases amyloid-beta production through a mechanism involving its interaction with both gamma-secretase and its substrate, the amyloid-beta precursor protein (APP; MIM 104760) C-terminal fragment (APP-CTF) (He et al., 2010 [PubMed 20811458]).[supplied by OMIM, Nov 2010]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Allc	A	T	12: 28,555,306	N331K	probably benign	Het
Anapc1	G	T	2: 128,675,701	S341*	probably null	Het
Cacna1e	T	C	1: 154,443,937	E1339G	probably damaging	Het
Cacna2d1	T	A	5: 16,352,678	I702N	probably damaging	Het
Casp2	C	A	6: 42,269,334	H209N	probably benign	Het
Casr	A	G	16: 36,510,030	V314A	probably benign	Het
Ccne2	A	T	4: 11,201,353	R294*	probably null	Het
Cd180	T	A	13: 102,704,834	H129Q	probably benign	Het
Chst10	A	T	1: 38,865,527	Y362N	probably damaging	Het
Ctnna1	T	A	18: 35,239,520	D509E	probably benign	Het
Ctsh	G	T	9: 90,060,511		probably null	Het
Dhx29	C	T	13: 112,944,539	A369V	possibly damaging	Het
Enox1	A	G	14: 77,592,974	T340A	probably benign	Het
Fam135b	T	A	15: 71,446,043	T1357S	probably benign	Het
Flt3	A	T	5: 147,355,083	S544T	possibly damaging	Het
Gm12689	T	C	4: 99,296,165	I85T	unknown	Het
Hnrnpr	C	T	4: 136,319,434	T142M	probably damaging	Het
Jak3	A	G	8: 71,678,773	D94G	probably benign	Het
Ktn1	A	T	14: 47,690,920	E579D	probably damaging	Het
Lama2	G	A	10: 27,041,189	P2247S	possibly damaging	Het
Lrba	C	T	3: 86,542,641	S2089F	probably damaging	Het
Map1b	C	T	13: 99,429,338	V2292M	unknown	Het
Mphosph10	A	T	7: 64,389,445		probably null	Het
Pappa	C	T	4: 65,205,152	T908M	probably benign	Het
Pdcd10	T	A	3: 75,521,057	K150*	probably null	Het
Piezo2	A	T	18: 63,027,864	I2275N	probably damaging	Het
Pmvk	T	C	3: 89,467,682		probably null	Het
Pold2	G	A	11: 5,873,048	P376S	probably damaging	Het
Prtg	A	T	9: 72,891,965	Q759L	probably damaging	Het
Rad51ap1	C	T	6: 126,928,227	S107N	probably damaging	Het
Rfk	T	A	19: 17,395,202	N29K	probably damaging	Het
Ror2	T	C	13: 53,117,339	M315V	probably benign	Het
Rrn3	A	G	16: 13,813,100	E600G	probably benign	Het
Ryk	A	G	9: 102,906,954	Y593C	possibly damaging	Het
Slc30a3	T	A	5: 31,088,660	D193V	probably damaging	Het
Slc35e2	C	T	4: 155,610,026	P10L	probably benign	Het
Srbd1	C	A	17: 86,119,942	C421F	possibly damaging	Het
Sstr5	A	C	17: 25,492,069	V62G	probably damaging	Het
Tfip11	G	A	5: 112,334,325	W483*	probably null	Het
Tlk1	T	C	2: 70,721,668	H553R	probably benign	Het
Tnc	T	C	4: 64,013,925		probably null	Het
Trav12-1	A	G	14: 53,538,473	T27A	probably damaging	Het
Usp9y	G	A	Y: 1,364,714	T1033I	probably benign	Het
V1ra8	C	T	6: 90,203,204	H130Y	probably benign	Het
Vmn2r77	A	T	7: 86,802,063	M386L	probably benign	Het

Other mutations in Gsap

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00788:Gsap	APN	5	21221305	splice site	probably benign
IGL00788:Gsap	APN	5	21254024	missense	probably damaging	0.96
IGL01344:Gsap	APN	5	21242883	critical splice donor site	probably null
IGL01347:Gsap	APN	5	21226320	missense	probably benign	0.08
IGL01618:Gsap	APN	5	21226248	missense	probably damaging	1.00
IGL01730:Gsap	APN	5	21290154	unclassified	probably benign
IGL02061:Gsap	APN	5	21281611	splice site	probably benign
IGL02161:Gsap	APN	5	21253379	missense	probably damaging	1.00
IGL02259:Gsap	APN	5	21186400	missense	probably benign	0.01
IGL02635:Gsap	APN	5	21289816	missense	probably damaging	1.00
IGL02684:Gsap	APN	5	21242803	critical splice acceptor site	probably null
IGL02822:Gsap	APN	5	21217444	missense	probably damaging	1.00
IGL03231:Gsap	APN	5	21229166	missense	probably damaging	0.99
PIT4305001:Gsap	UTSW	5	21186409	missense	probably damaging	0.98
R0012:Gsap	UTSW	5	21226229	splice site	probably benign
R0012:Gsap	UTSW	5	21226229	splice site	probably benign
R0019:Gsap	UTSW	5	21270622	splice site	probably benign
R0019:Gsap	UTSW	5	21270622	splice site	probably benign
R0045:Gsap	UTSW	5	21226832	missense	possibly damaging	0.77
R0054:Gsap	UTSW	5	21250935	splice site	probably benign
R0054:Gsap	UTSW	5	21250935	splice site	probably benign
R0409:Gsap	UTSW	5	21222445	splice site	probably benign
R0507:Gsap	UTSW	5	21269963	missense	possibly damaging	0.75
R0624:Gsap	UTSW	5	21253951	splice site	probably null
R1037:Gsap	UTSW	5	21251165	splice site	probably benign
R1076:Gsap	UTSW	5	21287694	missense	possibly damaging	0.75
R1459:Gsap	UTSW	5	21207238	splice site	probably benign
R1757:Gsap	UTSW	5	21281037	missense	probably damaging	0.98
R1852:Gsap	UTSW	5	21290545	splice site	probably null
R2034:Gsap	UTSW	5	21270595	missense	probably damaging	1.00
R2069:Gsap	UTSW	5	21226839	splice site	probably benign
R2125:Gsap	UTSW	5	21242813	missense	probably damaging	1.00
R2172:Gsap	UTSW	5	21222440	critical splice donor site	probably null
R2310:Gsap	UTSW	5	21196090	nonsense	probably null
R2337:Gsap	UTSW	5	21288630	missense	probably damaging	1.00
R3442:Gsap	UTSW	5	21278127	missense	probably damaging	1.00
R4229:Gsap	UTSW	5	21246977	missense	probably benign	0.00
R4271:Gsap	UTSW	5	21226350	critical splice donor site	probably null
R4551:Gsap	UTSW	5	21290571	missense	probably damaging	1.00
R4553:Gsap	UTSW	5	21290571	missense	probably damaging	1.00
R4649:Gsap	UTSW	5	21226311	missense	probably damaging	1.00
R4687:Gsap	UTSW	5	21246971	utr 3 prime	probably benign
R4799:Gsap	UTSW	5	21250943	missense	probably benign	0.05
R4857:Gsap	UTSW	5	21287799	splice site	probably null
R4973:Gsap	UTSW	5	21254039	missense	probably benign	0.04
R5015:Gsap	UTSW	5	21222408	missense	probably damaging	1.00
R5031:Gsap	UTSW	5	21242826	missense	possibly damaging	0.57
R5120:Gsap	UTSW	5	21269936	missense	probably damaging	0.96
R5451:Gsap	UTSW	5	21217447	missense	probably damaging	1.00
R5519:Gsap	UTSW	5	21289859	missense	probably damaging	1.00
R5588:Gsap	UTSW	5	21251149	missense	probably damaging	1.00
R5650:Gsap	UTSW	5	21251053	missense	probably damaging	0.99
R6064:Gsap	UTSW	5	21229225	missense	possibly damaging	0.56
R6139:Gsap	UTSW	5	21281540	missense	probably damaging	1.00
R6148:Gsap	UTSW	5	21226325	missense	probably damaging	1.00
R6148:Gsap	UTSW	5	21270577	missense	probably benign	0.39
R6226:Gsap	UTSW	5	21217431	missense	probably damaging	1.00
R6859:Gsap	UTSW	5	21281018	missense	probably damaging	0.99
R6977:Gsap	UTSW	5	21271221	missense	probably damaging	1.00
R6995:Gsap	UTSW	5	21271237	missense	possibly damaging	0.58
R7013:Gsap	UTSW	5	21278110	missense	probably benign	0.39
R7159:Gsap	UTSW	5	21270620	splice site	probably null
R7181:Gsap	UTSW	5	21253429	missense	probably damaging	1.00
R7234:Gsap	UTSW	5	21186435	missense	probably benign
R7332:Gsap	UTSW	5	21290121	missense	probably benign	0.00
R7381:Gsap	UTSW	5	21226787	missense	probably damaging	0.96
R8047:Gsap	UTSW	5	21257868	critical splice acceptor site	probably null
R8062:Gsap	UTSW	5	21194463	missense	probably damaging	1.00
R8126:Gsap	UTSW	5	21270012	missense	probably benign	0.04
R8219:Gsap	UTSW	5	21251115	missense	probably benign	0.00
Z1177:Gsap	UTSW	5	21251032	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ACTGAAAGGGCCTTGAGGTG -3'
(R):5'- GACCTGTTCCCAATCTTAAAGAC -3'

Sequencing Primer
(F):5'- GCCTTGAGGTGTTTAAACCAAAGC -3'
(R):5'- CCTGTTCCCAATCTTAAAGACAGTGG -3'

Posted On

2016-10-06