Incidental Mutation 'R5469:Gsap'
ID433400
Institutional Source Beutler Lab
Gene Symbol Gsap
Ensembl Gene ENSMUSG00000039934
Gene Namegamma-secretase activating protein
SynonymsA530088I07Rik, Pion
MMRRC Submission 043030-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R5469 (G1)
Quality Score195
Status Not validated
Chromosome5
Chromosomal Location21186255-21315132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21290544 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 831 (Y831F)
Ref Sequence ENSEMBL: ENSMUSP00000043679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036031] [ENSMUST00000115245] [ENSMUST00000195969] [ENSMUST00000198014] [ENSMUST00000198930] [ENSMUST00000198937]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036031
AA Change: Y831F

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043679
Gene: ENSMUSG00000039934
AA Change: Y831F

DomainStartEndE-ValueType
low complexity region 386 398 N/A INTRINSIC
Pfam:GSAP-16 646 753 6.8e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115245
SMART Domains Protein: ENSMUSP00000110900
Gene: ENSMUSG00000064280

DomainStartEndE-ValueType
coiled coil region 1 33 N/A INTRINSIC
low complexity region 120 130 N/A INTRINSIC
coiled coil region 194 320 N/A INTRINSIC
low complexity region 333 342 N/A INTRINSIC
coiled coil region 438 477 N/A INTRINSIC
coiled coil region 549 595 N/A INTRINSIC
coiled coil region 617 663 N/A INTRINSIC
coiled coil region 690 720 N/A INTRINSIC
coiled coil region 770 793 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195969
Predicted Effect probably benign
Transcript: ENSMUST00000198014
Predicted Effect possibly damaging
Transcript: ENSMUST00000198930
AA Change: Y70F

PolyPhen 2 Score 0.538 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000198937
SMART Domains Protein: ENSMUSP00000142986
Gene: ENSMUSG00000039934

DomainStartEndE-ValueType
low complexity region 355 367 N/A INTRINSIC
Pfam:GSAP-16 608 722 1.6e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199553
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Accumulation of neurotoxic amyloid-beta is a major hallmark of Alzheimer disease (AD; MIM 104300). Formation of amyloid-beta is catalyzed by gamma-secretase (see PSEN1; MIM 104311), a protease with numerous substrates. PION, or GSAP, selectively increases amyloid-beta production through a mechanism involving its interaction with both gamma-secretase and its substrate, the amyloid-beta precursor protein (APP; MIM 104760) C-terminal fragment (APP-CTF) (He et al., 2010 [PubMed 20811458]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Allc A T 12: 28,555,306 N331K probably benign Het
Anapc1 G T 2: 128,675,701 S341* probably null Het
Cacna1e T C 1: 154,443,937 E1339G probably damaging Het
Cacna2d1 T A 5: 16,352,678 I702N probably damaging Het
Casp2 C A 6: 42,269,334 H209N probably benign Het
Casr A G 16: 36,510,030 V314A probably benign Het
Ccne2 A T 4: 11,201,353 R294* probably null Het
Cd180 T A 13: 102,704,834 H129Q probably benign Het
Chst10 A T 1: 38,865,527 Y362N probably damaging Het
Ctnna1 T A 18: 35,239,520 D509E probably benign Het
Ctsh G T 9: 90,060,511 probably null Het
Dhx29 C T 13: 112,944,539 A369V possibly damaging Het
Enox1 A G 14: 77,592,974 T340A probably benign Het
Fam135b T A 15: 71,446,043 T1357S probably benign Het
Flt3 A T 5: 147,355,083 S544T possibly damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Hnrnpr C T 4: 136,319,434 T142M probably damaging Het
Jak3 A G 8: 71,678,773 D94G probably benign Het
Ktn1 A T 14: 47,690,920 E579D probably damaging Het
Lama2 G A 10: 27,041,189 P2247S possibly damaging Het
Lrba C T 3: 86,542,641 S2089F probably damaging Het
Map1b C T 13: 99,429,338 V2292M unknown Het
Mphosph10 A T 7: 64,389,445 probably null Het
Pappa C T 4: 65,205,152 T908M probably benign Het
Pdcd10 T A 3: 75,521,057 K150* probably null Het
Piezo2 A T 18: 63,027,864 I2275N probably damaging Het
Pmvk T C 3: 89,467,682 probably null Het
Pold2 G A 11: 5,873,048 P376S probably damaging Het
Prtg A T 9: 72,891,965 Q759L probably damaging Het
Rad51ap1 C T 6: 126,928,227 S107N probably damaging Het
Rfk T A 19: 17,395,202 N29K probably damaging Het
Ror2 T C 13: 53,117,339 M315V probably benign Het
Rrn3 A G 16: 13,813,100 E600G probably benign Het
Ryk A G 9: 102,906,954 Y593C possibly damaging Het
Slc30a3 T A 5: 31,088,660 D193V probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Srbd1 C A 17: 86,119,942 C421F possibly damaging Het
Sstr5 A C 17: 25,492,069 V62G probably damaging Het
Tfip11 G A 5: 112,334,325 W483* probably null Het
Tlk1 T C 2: 70,721,668 H553R probably benign Het
Tnc T C 4: 64,013,925 probably null Het
Trav12-1 A G 14: 53,538,473 T27A probably damaging Het
Usp9y G A Y: 1,364,714 T1033I probably benign Het
V1ra8 C T 6: 90,203,204 H130Y probably benign Het
Vmn2r77 A T 7: 86,802,063 M386L probably benign Het
Other mutations in Gsap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Gsap APN 5 21221305 splice site probably benign
IGL00788:Gsap APN 5 21254024 missense probably damaging 0.96
IGL01344:Gsap APN 5 21242883 critical splice donor site probably null
IGL01347:Gsap APN 5 21226320 missense probably benign 0.08
IGL01618:Gsap APN 5 21226248 missense probably damaging 1.00
IGL01730:Gsap APN 5 21290154 unclassified probably benign
IGL02061:Gsap APN 5 21281611 splice site probably benign
IGL02161:Gsap APN 5 21253379 missense probably damaging 1.00
IGL02259:Gsap APN 5 21186400 missense probably benign 0.01
IGL02635:Gsap APN 5 21289816 missense probably damaging 1.00
IGL02684:Gsap APN 5 21242803 critical splice acceptor site probably null
IGL02822:Gsap APN 5 21217444 missense probably damaging 1.00
IGL03231:Gsap APN 5 21229166 missense probably damaging 0.99
PIT4305001:Gsap UTSW 5 21186409 missense probably damaging 0.98
R0012:Gsap UTSW 5 21226229 splice site probably benign
R0012:Gsap UTSW 5 21226229 splice site probably benign
R0019:Gsap UTSW 5 21270622 splice site probably benign
R0019:Gsap UTSW 5 21270622 splice site probably benign
R0045:Gsap UTSW 5 21226832 missense possibly damaging 0.77
R0054:Gsap UTSW 5 21250935 splice site probably benign
R0054:Gsap UTSW 5 21250935 splice site probably benign
R0409:Gsap UTSW 5 21222445 splice site probably benign
R0507:Gsap UTSW 5 21269963 missense possibly damaging 0.75
R0624:Gsap UTSW 5 21253951 splice site probably null
R1037:Gsap UTSW 5 21251165 splice site probably benign
R1076:Gsap UTSW 5 21287694 missense possibly damaging 0.75
R1459:Gsap UTSW 5 21207238 splice site probably benign
R1757:Gsap UTSW 5 21281037 missense probably damaging 0.98
R1852:Gsap UTSW 5 21290545 splice site probably null
R2034:Gsap UTSW 5 21270595 missense probably damaging 1.00
R2069:Gsap UTSW 5 21226839 splice site probably benign
R2125:Gsap UTSW 5 21242813 missense probably damaging 1.00
R2172:Gsap UTSW 5 21222440 critical splice donor site probably null
R2310:Gsap UTSW 5 21196090 nonsense probably null
R2337:Gsap UTSW 5 21288630 missense probably damaging 1.00
R3442:Gsap UTSW 5 21278127 missense probably damaging 1.00
R4229:Gsap UTSW 5 21246977 missense probably benign 0.00
R4271:Gsap UTSW 5 21226350 critical splice donor site probably null
R4551:Gsap UTSW 5 21290571 missense probably damaging 1.00
R4553:Gsap UTSW 5 21290571 missense probably damaging 1.00
R4649:Gsap UTSW 5 21226311 missense probably damaging 1.00
R4687:Gsap UTSW 5 21246971 utr 3 prime probably benign
R4799:Gsap UTSW 5 21250943 missense probably benign 0.05
R4857:Gsap UTSW 5 21287799 splice site probably null
R4973:Gsap UTSW 5 21254039 missense probably benign 0.04
R5015:Gsap UTSW 5 21222408 missense probably damaging 1.00
R5031:Gsap UTSW 5 21242826 missense possibly damaging 0.57
R5120:Gsap UTSW 5 21269936 missense probably damaging 0.96
R5451:Gsap UTSW 5 21217447 missense probably damaging 1.00
R5519:Gsap UTSW 5 21289859 missense probably damaging 1.00
R5588:Gsap UTSW 5 21251149 missense probably damaging 1.00
R5650:Gsap UTSW 5 21251053 missense probably damaging 0.99
R6064:Gsap UTSW 5 21229225 missense possibly damaging 0.56
R6139:Gsap UTSW 5 21281540 missense probably damaging 1.00
R6148:Gsap UTSW 5 21226325 missense probably damaging 1.00
R6148:Gsap UTSW 5 21270577 missense probably benign 0.39
R6226:Gsap UTSW 5 21217431 missense probably damaging 1.00
R6859:Gsap UTSW 5 21281018 missense probably damaging 0.99
R6977:Gsap UTSW 5 21271221 missense probably damaging 1.00
R6995:Gsap UTSW 5 21271237 missense possibly damaging 0.58
R7013:Gsap UTSW 5 21278110 missense probably benign 0.39
R7159:Gsap UTSW 5 21270620 splice site probably null
R7181:Gsap UTSW 5 21253429 missense probably damaging 1.00
R7234:Gsap UTSW 5 21186435 missense probably benign
R7332:Gsap UTSW 5 21290121 missense probably benign 0.00
R7381:Gsap UTSW 5 21226787 missense probably damaging 0.96
R8047:Gsap UTSW 5 21257868 critical splice acceptor site probably null
R8062:Gsap UTSW 5 21194463 missense probably damaging 1.00
R8126:Gsap UTSW 5 21270012 missense probably benign 0.04
R8219:Gsap UTSW 5 21251115 missense probably benign 0.00
Z1177:Gsap UTSW 5 21251032 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTGAAAGGGCCTTGAGGTG -3'
(R):5'- GACCTGTTCCCAATCTTAAAGAC -3'

Sequencing Primer
(F):5'- GCCTTGAGGTGTTTAAACCAAAGC -3'
(R):5'- CCTGTTCCCAATCTTAAAGACAGTGG -3'
Posted On2016-10-06