Incidental Mutation 'R5469:Slc30a3'
ID433401
Institutional Source Beutler Lab
Gene Symbol Slc30a3
Ensembl Gene ENSMUSG00000029151
Gene Namesolute carrier family 30 (zinc transporter), member 3
SynonymsZnt3
MMRRC Submission 043030-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.269) question?
Stock #R5469 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location31086106-31108237 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31088660 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 193 (D193V)
Ref Sequence ENSEMBL: ENSMUSP00000144566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031037] [ENSMUST00000200906] [ENSMUST00000201396] [ENSMUST00000201783] [ENSMUST00000202731] [ENSMUST00000202740]
Predicted Effect probably damaging
Transcript: ENSMUST00000031037
AA Change: D242V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031037
Gene: ENSMUSG00000029151
AA Change: D242V

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
Pfam:Cation_efflux 76 293 7.6e-46 PFAM
Predicted Effect not run
Transcript: ENSMUST00000182444
AA Change: D193V
Predicted Effect probably benign
Transcript: ENSMUST00000200906
SMART Domains Protein: ENSMUSP00000144098
Gene: ENSMUSG00000029151

DomainStartEndE-ValueType
low complexity region 19 36 N/A INTRINSIC
Pfam:Cation_efflux 64 173 2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201396
SMART Domains Protein: ENSMUSP00000144295
Gene: ENSMUSG00000029151

DomainStartEndE-ValueType
Pfam:Cation_efflux 27 124 1.1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201783
Predicted Effect probably benign
Transcript: ENSMUST00000202731
SMART Domains Protein: ENSMUSP00000144574
Gene: ENSMUSG00000029151

DomainStartEndE-ValueType
low complexity region 50 58 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202740
AA Change: D193V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144566
Gene: ENSMUSG00000029151
AA Change: D193V

DomainStartEndE-ValueType
Pfam:Cation_efflux 27 244 3e-46 PFAM
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: While zinc is absent from synaptic vesicles in homozygous null mice, inactivation of this locus does not affect brain morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Allc A T 12: 28,555,306 N331K probably benign Het
Anapc1 G T 2: 128,675,701 S341* probably null Het
Cacna1e T C 1: 154,443,937 E1339G probably damaging Het
Cacna2d1 T A 5: 16,352,678 I702N probably damaging Het
Casp2 C A 6: 42,269,334 H209N probably benign Het
Casr A G 16: 36,510,030 V314A probably benign Het
Ccne2 A T 4: 11,201,353 R294* probably null Het
Cd180 T A 13: 102,704,834 H129Q probably benign Het
Chst10 A T 1: 38,865,527 Y362N probably damaging Het
Ctnna1 T A 18: 35,239,520 D509E probably benign Het
Ctsh G T 9: 90,060,511 probably null Het
Dhx29 C T 13: 112,944,539 A369V possibly damaging Het
Enox1 A G 14: 77,592,974 T340A probably benign Het
Fam135b T A 15: 71,446,043 T1357S probably benign Het
Flt3 A T 5: 147,355,083 S544T possibly damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Gsap A T 5: 21,290,544 Y831F possibly damaging Het
Hnrnpr C T 4: 136,319,434 T142M probably damaging Het
Jak3 A G 8: 71,678,773 D94G probably benign Het
Ktn1 A T 14: 47,690,920 E579D probably damaging Het
Lama2 G A 10: 27,041,189 P2247S possibly damaging Het
Lrba C T 3: 86,542,641 S2089F probably damaging Het
Map1b C T 13: 99,429,338 V2292M unknown Het
Mphosph10 A T 7: 64,389,445 probably null Het
Pappa C T 4: 65,205,152 T908M probably benign Het
Pdcd10 T A 3: 75,521,057 K150* probably null Het
Piezo2 A T 18: 63,027,864 I2275N probably damaging Het
Pmvk T C 3: 89,467,682 probably null Het
Pold2 G A 11: 5,873,048 P376S probably damaging Het
Prtg A T 9: 72,891,965 Q759L probably damaging Het
Rad51ap1 C T 6: 126,928,227 S107N probably damaging Het
Rfk T A 19: 17,395,202 N29K probably damaging Het
Ror2 T C 13: 53,117,339 M315V probably benign Het
Rrn3 A G 16: 13,813,100 E600G probably benign Het
Ryk A G 9: 102,906,954 Y593C possibly damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Srbd1 C A 17: 86,119,942 C421F possibly damaging Het
Sstr5 A C 17: 25,492,069 V62G probably damaging Het
Tfip11 G A 5: 112,334,325 W483* probably null Het
Tlk1 T C 2: 70,721,668 H553R probably benign Het
Tnc T C 4: 64,013,925 probably null Het
Trav12-1 A G 14: 53,538,473 T27A probably damaging Het
Usp9y G A Y: 1,364,714 T1033I probably benign Het
V1ra8 C T 6: 90,203,204 H130Y probably benign Het
Vmn2r77 A T 7: 86,802,063 M386L probably benign Het
Other mutations in Slc30a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00803:Slc30a3 APN 5 31088044 missense probably damaging 1.00
IGL01411:Slc30a3 APN 5 31090080 missense probably benign 0.00
IGL02678:Slc30a3 APN 5 31088332 nonsense probably null
R0606:Slc30a3 UTSW 5 31088723 missense probably benign 0.02
R1173:Slc30a3 UTSW 5 31086810 missense probably damaging 1.00
R1184:Slc30a3 UTSW 5 31090166 missense probably damaging 1.00
R1924:Slc30a3 UTSW 5 31088404 missense probably damaging 1.00
R2076:Slc30a3 UTSW 5 31086821 nonsense probably null
R2432:Slc30a3 UTSW 5 31088694 missense probably damaging 1.00
R3552:Slc30a3 UTSW 5 31095078 intron probably benign
R4011:Slc30a3 UTSW 5 31086859 missense probably damaging 1.00
R4731:Slc30a3 UTSW 5 31093294 missense probably benign
R4956:Slc30a3 UTSW 5 31086903 missense possibly damaging 0.92
R6364:Slc30a3 UTSW 5 31088739 missense possibly damaging 0.90
R6799:Slc30a3 UTSW 5 31089614 missense probably damaging 1.00
R7182:Slc30a3 UTSW 5 31086825 missense probably benign
R7182:Slc30a3 UTSW 5 31089670 missense probably damaging 1.00
R7195:Slc30a3 UTSW 5 31088795 missense probably benign 0.04
R7260:Slc30a3 UTSW 5 31088346 missense probably damaging 0.99
R8057:Slc30a3 UTSW 5 31090051 splice site probably benign
Predicted Primers PCR Primer
(F):5'- GGCTCTTCACAACCTGAAAGC -3'
(R):5'- CTTTCTGGGACGGGAAAGAG -3'

Sequencing Primer
(F):5'- TGAAAGCACCCTGGGACTCTTG -3'
(R):5'- GCCAAGAACAGGCCGTCTG -3'
Posted On2016-10-06