Mutagenetix > Incidental Mutations

Incidental Mutation 'R5469:Flt3'

433404

Institutional Source

Beutler Lab

Gene Symbol

Flt3

Ensembl Gene

ENSMUSG00000042817

Gene Name

FMS-like tyrosine kinase 3

Synonyms

Flt-3, CD135, Flk-2, wmfl, Flk2

MMRRC Submission

043030-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5469 (G1)

Quality Score

220

Status

Not validated

Chromosome

Chromosomal Location

147330741-147400489 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 147355083 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 544 (S544T)

Ref Sequence

ENSEMBL: ENSMUSP00000039041 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049324]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000049324
AA Change: S544T

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000039041
Gene: ENSMUSG00000042817
AA Change: S544T

Domain	Start	End	E-Value	Type
low complexity region	10	18	N/A	INTRINSIC
IG	79	162	1.87e0	SMART
IG	258	346	2.57e0	SMART
internal_repeat_1	380	529	8.53e-14	PROSPERO
TyrKc	611	946	1.7e-140	SMART

Coding Region Coverage

1x: 98.2%
3x: 97.3%
10x: 95.1%
20x: 90.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a class III receptor tyrosine kinase that regulates hematopoiesis. This receptor is activated by binding of the fms-related tyrosine kinase 3 ligand to the extracellular domain, which induces homodimer formation in the plasma membrane leading to autophosphorylation of the receptor. The activated receptor kinase subsequently phosphorylates and activates multiple cytoplasmic effector molecules in pathways involved in apoptosis, proliferation, and differentiation of hematopoietic cells in bone marrow. Mutations that result in the constitutive activation of this receptor result in acute myeloid leukemia and acute lymphoblastic leukemia. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice functionally null for this gene display abnormal lymphopoiesis. Homozygous ENU mutant mice are sensitive to infection by mouse cytomegalovirus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Allc	A	T	12: 28,555,306	N331K	probably benign	Het
Anapc1	G	T	2: 128,675,701	S341*	probably null	Het
Cacna1e	T	C	1: 154,443,937	E1339G	probably damaging	Het
Cacna2d1	T	A	5: 16,352,678	I702N	probably damaging	Het
Casp2	C	A	6: 42,269,334	H209N	probably benign	Het
Casr	A	G	16: 36,510,030	V314A	probably benign	Het
Ccne2	A	T	4: 11,201,353	R294*	probably null	Het
Cd180	T	A	13: 102,704,834	H129Q	probably benign	Het
Chst10	A	T	1: 38,865,527	Y362N	probably damaging	Het
Ctnna1	T	A	18: 35,239,520	D509E	probably benign	Het
Ctsh	G	T	9: 90,060,511		probably null	Het
Dhx29	C	T	13: 112,944,539	A369V	possibly damaging	Het
Enox1	A	G	14: 77,592,974	T340A	probably benign	Het
Fam135b	T	A	15: 71,446,043	T1357S	probably benign	Het
Gm12689	T	C	4: 99,296,165	I85T	unknown	Het
Gsap	A	T	5: 21,290,544	Y831F	possibly damaging	Het
Hnrnpr	C	T	4: 136,319,434	T142M	probably damaging	Het
Jak3	A	G	8: 71,678,773	D94G	probably benign	Het
Ktn1	A	T	14: 47,690,920	E579D	probably damaging	Het
Lama2	G	A	10: 27,041,189	P2247S	possibly damaging	Het
Lrba	C	T	3: 86,542,641	S2089F	probably damaging	Het
Map1b	C	T	13: 99,429,338	V2292M	unknown	Het
Mphosph10	A	T	7: 64,389,445		probably null	Het
Pappa	C	T	4: 65,205,152	T908M	probably benign	Het
Pdcd10	T	A	3: 75,521,057	K150*	probably null	Het
Piezo2	A	T	18: 63,027,864	I2275N	probably damaging	Het
Pmvk	T	C	3: 89,467,682		probably null	Het
Pold2	G	A	11: 5,873,048	P376S	probably damaging	Het
Prtg	A	T	9: 72,891,965	Q759L	probably damaging	Het
Rad51ap1	C	T	6: 126,928,227	S107N	probably damaging	Het
Rfk	T	A	19: 17,395,202	N29K	probably damaging	Het
Ror2	T	C	13: 53,117,339	M315V	probably benign	Het
Rrn3	A	G	16: 13,813,100	E600G	probably benign	Het
Ryk	A	G	9: 102,906,954	Y593C	possibly damaging	Het
Slc30a3	T	A	5: 31,088,660	D193V	probably damaging	Het
Slc35e2	C	T	4: 155,610,026	P10L	probably benign	Het
Srbd1	C	A	17: 86,119,942	C421F	possibly damaging	Het
Sstr5	A	C	17: 25,492,069	V62G	probably damaging	Het
Tfip11	G	A	5: 112,334,325	W483*	probably null	Het
Tlk1	T	C	2: 70,721,668	H553R	probably benign	Het
Tnc	T	C	4: 64,013,925		probably null	Het
Trav12-1	A	G	14: 53,538,473	T27A	probably damaging	Het
Usp9y	G	A	Y: 1,364,714	T1033I	probably benign	Het
V1ra8	C	T	6: 90,203,204	H130Y	probably benign	Het
Vmn2r77	A	T	7: 86,802,063	M386L	probably benign	Het

Other mutations in Flt3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Flt3	APN	5	147354876	missense	probably damaging	1.00
IGL01083:Flt3	APN	5	147354870	missense	probably damaging	1.00
IGL01749:Flt3	APN	5	147358028	missense	probably benign	0.02
IGL01765:Flt3	APN	5	147357978	missense	probably benign
IGL02109:Flt3	APN	5	147350681	missense	probably benign	0.00
IGL02490:Flt3	APN	5	147331296	missense	probably damaging	1.00
IGL02631:Flt3	APN	5	147344552	missense	probably damaging	1.00
IGL03117:Flt3	APN	5	147356210	missense	probably benign
flick	UTSW	5	147341238	missense	probably damaging	1.00
warmflash	UTSW	5	147366918	critical splice donor site	probably null
R0070:Flt3	UTSW	5	147372726	splice site	probably benign
R0070:Flt3	UTSW	5	147372726	splice site	probably benign
R0320:Flt3	UTSW	5	147369579	splice site	probably benign
R0347:Flt3	UTSW	5	147357992	missense	probably damaging	1.00
R0512:Flt3	UTSW	5	147341270	nonsense	probably null
R0968:Flt3	UTSW	5	147341227	missense	possibly damaging	0.46
R1180:Flt3	UTSW	5	147341238	missense	probably damaging	1.00
R1266:Flt3	UTSW	5	147356860	missense	probably benign	0.00
R1562:Flt3	UTSW	5	147344513	missense	probably damaging	1.00
R1803:Flt3	UTSW	5	147367055	nonsense	probably null
R2000:Flt3	UTSW	5	147341238	missense	probably damaging	1.00
R2021:Flt3	UTSW	5	147369490	missense	probably damaging	0.98
R2079:Flt3	UTSW	5	147355083	missense	probably damaging	0.97
R2261:Flt3	UTSW	5	147348063	missense	probably benign	0.00
R2263:Flt3	UTSW	5	147348063	missense	probably benign	0.00
R3087:Flt3	UTSW	5	147348046	missense	probably benign	0.15
R3727:Flt3	UTSW	5	147354923	missense	probably damaging	0.96
R3939:Flt3	UTSW	5	147356243	missense	possibly damaging	0.87
R4469:Flt3	UTSW	5	147375644	splice site	silent
R4527:Flt3	UTSW	5	147356353	missense	probably benign	0.37
R4592:Flt3	UTSW	5	147354699	missense	possibly damaging	0.67
R4655:Flt3	UTSW	5	147349593	missense	possibly damaging	0.51
R4686:Flt3	UTSW	5	147377048	missense	probably damaging	1.00
R4867:Flt3	UTSW	5	147334440	missense	probably damaging	1.00
R4897:Flt3	UTSW	5	147369300	missense	probably damaging	1.00
R4941:Flt3	UTSW	5	147356375	critical splice acceptor site	probably null
R5254:Flt3	UTSW	5	147375690	missense	possibly damaging	0.60
R5325:Flt3	UTSW	5	147375649	missense	probably benign	0.00
R5395:Flt3	UTSW	5	147354823	missense	probably damaging	1.00
R5445:Flt3	UTSW	5	147355095	nonsense	probably null
R5556:Flt3	UTSW	5	147332997	splice site	probably null
R5660:Flt3	UTSW	5	147369481	missense	possibly damaging	0.79
R5879:Flt3	UTSW	5	147334909	missense	probably damaging	1.00
R5885:Flt3	UTSW	5	147349629	missense	probably damaging	1.00
R6554:Flt3	UTSW	5	147375735	missense	probably damaging	0.99
R6813:Flt3	UTSW	5	147354843	missense	probably damaging	0.97
R7451:Flt3	UTSW	5	147349667	missense	probably damaging	1.00
R7469:Flt3	UTSW	5	147331274	missense	probably benign	0.18
R7537:Flt3	UTSW	5	147334437	missense	probably damaging	1.00
R7605:Flt3	UTSW	5	147349576	missense	probably benign	0.01
R7651:Flt3	UTSW	5	147354922	missense	probably damaging	1.00
R7842:Flt3	UTSW	5	147334453	missense	probably damaging	1.00
R8051:Flt3	UTSW	5	147358955	intron	probably benign
R8236:Flt3	UTSW	5	147356860	missense	probably benign	0.00
R8305:Flt3	UTSW	5	147348054	missense	probably damaging	0.96
R8337:Flt3	UTSW	5	147332888	critical splice donor site	probably null
X0018:Flt3	UTSW	5	147367066	missense	possibly damaging	0.54
Z1088:Flt3	UTSW	5	147349564	critical splice donor site	probably null
Z1177:Flt3	UTSW	5	147383401	missense	probably benign	0.27
Z31818:Flt3	UTSW	5	147366918	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GGATCATCTGCAGCTGACTCTC -3'
(R):5'- TCTGGGGACTCATTGTTTACAG -3'

Sequencing Primer
(F):5'- GACTCTCGTACCTAAATTGCTTGAG -3'
(R):5'- CCAACTTTCTGTGGGGCAC -3'

Posted On

2016-10-06