Incidental Mutation 'R5469:Vmn2r77'
ID433409
Institutional Source Beutler Lab
Gene Symbol Vmn2r77
Ensembl Gene ENSMUSG00000090949
Gene Namevomeronasal 2, receptor 77
SynonymsEG546983
MMRRC Submission 043030-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R5469 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location86795141-86812032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86802063 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 386 (M386L)
Ref Sequence ENSEMBL: ENSMUSP00000129540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164996]
Predicted Effect probably benign
Transcript: ENSMUST00000164996
AA Change: M386L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000129540
Gene: ENSMUSG00000090949
AA Change: M386L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 78 467 1.4e-30 PFAM
Pfam:NCD3G 510 562 1e-20 PFAM
Pfam:7tm_3 594 830 2.6e-52 PFAM
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Allc A T 12: 28,555,306 N331K probably benign Het
Anapc1 G T 2: 128,675,701 S341* probably null Het
Cacna1e T C 1: 154,443,937 E1339G probably damaging Het
Cacna2d1 T A 5: 16,352,678 I702N probably damaging Het
Casp2 C A 6: 42,269,334 H209N probably benign Het
Casr A G 16: 36,510,030 V314A probably benign Het
Ccne2 A T 4: 11,201,353 R294* probably null Het
Cd180 T A 13: 102,704,834 H129Q probably benign Het
Chst10 A T 1: 38,865,527 Y362N probably damaging Het
Ctnna1 T A 18: 35,239,520 D509E probably benign Het
Ctsh G T 9: 90,060,511 probably null Het
Dhx29 C T 13: 112,944,539 A369V possibly damaging Het
Enox1 A G 14: 77,592,974 T340A probably benign Het
Fam135b T A 15: 71,446,043 T1357S probably benign Het
Flt3 A T 5: 147,355,083 S544T possibly damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Gsap A T 5: 21,290,544 Y831F possibly damaging Het
Hnrnpr C T 4: 136,319,434 T142M probably damaging Het
Jak3 A G 8: 71,678,773 D94G probably benign Het
Ktn1 A T 14: 47,690,920 E579D probably damaging Het
Lama2 G A 10: 27,041,189 P2247S possibly damaging Het
Lrba C T 3: 86,542,641 S2089F probably damaging Het
Map1b C T 13: 99,429,338 V2292M unknown Het
Mphosph10 A T 7: 64,389,445 probably null Het
Pappa C T 4: 65,205,152 T908M probably benign Het
Pdcd10 T A 3: 75,521,057 K150* probably null Het
Piezo2 A T 18: 63,027,864 I2275N probably damaging Het
Pmvk T C 3: 89,467,682 probably null Het
Pold2 G A 11: 5,873,048 P376S probably damaging Het
Prtg A T 9: 72,891,965 Q759L probably damaging Het
Rad51ap1 C T 6: 126,928,227 S107N probably damaging Het
Rfk T A 19: 17,395,202 N29K probably damaging Het
Ror2 T C 13: 53,117,339 M315V probably benign Het
Rrn3 A G 16: 13,813,100 E600G probably benign Het
Ryk A G 9: 102,906,954 Y593C possibly damaging Het
Slc30a3 T A 5: 31,088,660 D193V probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Srbd1 C A 17: 86,119,942 C421F possibly damaging Het
Sstr5 A C 17: 25,492,069 V62G probably damaging Het
Tfip11 G A 5: 112,334,325 W483* probably null Het
Tlk1 T C 2: 70,721,668 H553R probably benign Het
Tnc T C 4: 64,013,925 probably null Het
Trav12-1 A G 14: 53,538,473 T27A probably damaging Het
Usp9y G A Y: 1,364,714 T1033I probably benign Het
V1ra8 C T 6: 90,203,204 H130Y probably benign Het
Other mutations in Vmn2r77
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Vmn2r77 APN 7 86800767 missense probably benign 0.06
IGL01105:Vmn2r77 APN 7 86811664 missense probably damaging 0.99
IGL01367:Vmn2r77 APN 7 86811916 missense probably damaging 0.98
IGL01634:Vmn2r77 APN 7 86811649 missense probably benign
IGL01805:Vmn2r77 APN 7 86811187 missense probably benign 0.18
IGL01868:Vmn2r77 APN 7 86803016 missense probably benign 0.00
IGL01980:Vmn2r77 APN 7 86801470 missense probably benign 0.14
IGL02055:Vmn2r77 APN 7 86801555 missense probably benign 0.00
IGL02066:Vmn2r77 APN 7 86803628 nonsense probably null
IGL02185:Vmn2r77 APN 7 86795152 missense unknown
IGL02200:Vmn2r77 APN 7 86801979 missense probably benign 0.04
IGL02336:Vmn2r77 APN 7 86802016 missense probably damaging 0.99
IGL02445:Vmn2r77 APN 7 86803640 nonsense probably null
IGL02557:Vmn2r77 APN 7 86795134 unclassified probably benign
IGL02659:Vmn2r77 APN 7 86800771 missense probably benign 0.32
IGL02978:Vmn2r77 APN 7 86811347 missense probably benign
IGL03180:Vmn2r77 APN 7 86801635 missense possibly damaging 0.85
IGL03255:Vmn2r77 APN 7 86811923 missense probably benign 0.04
IGL03273:Vmn2r77 APN 7 86811286 missense probably damaging 0.99
R0046:Vmn2r77 UTSW 7 86801938 missense possibly damaging 0.73
R0047:Vmn2r77 UTSW 7 86811650 missense probably benign 0.01
R0066:Vmn2r77 UTSW 7 86800756 missense probably benign 0.17
R0066:Vmn2r77 UTSW 7 86800756 missense probably benign 0.17
R0389:Vmn2r77 UTSW 7 86801494 missense probably benign 0.29
R0635:Vmn2r77 UTSW 7 86811175 missense probably benign
R0689:Vmn2r77 UTSW 7 86811664 missense probably damaging 0.99
R0827:Vmn2r77 UTSW 7 86802016 missense probably damaging 1.00
R1167:Vmn2r77 UTSW 7 86801746 missense probably benign 0.02
R1228:Vmn2r77 UTSW 7 86801034 critical splice donor site probably null
R1353:Vmn2r77 UTSW 7 86802186 missense probably benign 0.29
R1392:Vmn2r77 UTSW 7 86801622 missense probably benign 0.00
R1392:Vmn2r77 UTSW 7 86801622 missense probably benign 0.00
R1613:Vmn2r77 UTSW 7 86811148 missense probably damaging 1.00
R1654:Vmn2r77 UTSW 7 86811915 missense probably damaging 1.00
R1742:Vmn2r77 UTSW 7 86795335 missense probably benign 0.35
R1827:Vmn2r77 UTSW 7 86801613 missense probably damaging 0.99
R1911:Vmn2r77 UTSW 7 86811793 missense probably damaging 1.00
R1974:Vmn2r77 UTSW 7 86800756 missense probably benign 0.17
R2008:Vmn2r77 UTSW 7 86801713 missense probably benign 0.31
R2093:Vmn2r77 UTSW 7 86801494 missense probably benign 0.29
R2143:Vmn2r77 UTSW 7 86811944 missense probably damaging 1.00
R2269:Vmn2r77 UTSW 7 86811689 missense probably benign 0.03
R2972:Vmn2r77 UTSW 7 86803685 missense probably benign 0.01
R2974:Vmn2r77 UTSW 7 86803685 missense probably benign 0.01
R3037:Vmn2r77 UTSW 7 86800983 missense probably benign
R3694:Vmn2r77 UTSW 7 86800836 missense probably damaging 1.00
R3695:Vmn2r77 UTSW 7 86800836 missense probably damaging 1.00
R3805:Vmn2r77 UTSW 7 86795160 nonsense probably null
R3870:Vmn2r77 UTSW 7 86811842 missense probably damaging 1.00
R4732:Vmn2r77 UTSW 7 86800987 missense probably benign 0.00
R4733:Vmn2r77 UTSW 7 86800987 missense probably benign 0.00
R5009:Vmn2r77 UTSW 7 86801807 missense possibly damaging 0.82
R5201:Vmn2r77 UTSW 7 86811638 missense probably damaging 0.98
R5218:Vmn2r77 UTSW 7 86802133 missense probably damaging 0.98
R5673:Vmn2r77 UTSW 7 86812006 missense probably benign 0.05
R5771:Vmn2r77 UTSW 7 86812027 missense probably benign 0.06
R5832:Vmn2r77 UTSW 7 86811462 nonsense probably null
R5899:Vmn2r77 UTSW 7 86811716 missense probably damaging 1.00
R6151:Vmn2r77 UTSW 7 86801670 missense probably benign 0.00
R6182:Vmn2r77 UTSW 7 86811749 missense probably damaging 1.00
R6326:Vmn2r77 UTSW 7 86801823 missense probably benign
R6419:Vmn2r77 UTSW 7 86811559 missense probably damaging 0.99
R6549:Vmn2r77 UTSW 7 86800857 missense probably benign 0.06
R6874:Vmn2r77 UTSW 7 86802078 missense probably benign 0.00
R6972:Vmn2r77 UTSW 7 86802994 missense probably damaging 1.00
R7056:Vmn2r77 UTSW 7 86801815 missense probably benign 0.06
R7185:Vmn2r77 UTSW 7 86801827 missense probably benign 0.00
R7261:Vmn2r77 UTSW 7 86811310 nonsense probably null
R7298:Vmn2r77 UTSW 7 86800771 missense probably benign 0.00
R7662:Vmn2r77 UTSW 7 86811284 nonsense probably null
R8182:Vmn2r77 UTSW 7 86811593 missense probably damaging 1.00
R8327:Vmn2r77 UTSW 7 86801472 missense probably benign 0.08
R8387:Vmn2r77 UTSW 7 86801739 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GATCACAATGATGGGAGATTTCATGC -3'
(R):5'- TCCCATTAGGAATGTCGTTTCTATG -3'

Sequencing Primer
(F):5'- CACATCAACAGTCTGAGATGTCTGG -3'
(R):5'- CATTCTCTGAGGATGTGTC -3'
Posted On2016-10-06