Incidental Mutation 'R5469:Ctsh'
ID433412
Institutional Source Beutler Lab
Gene Symbol Ctsh
Ensembl Gene ENSMUSG00000032359
Gene Namecathepsin H
SynonymsCat H
MMRRC Submission 043030-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5469 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location90054152-90076089 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 90060511 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034915] [ENSMUST00000123320] [ENSMUST00000132718] [ENSMUST00000132718] [ENSMUST00000143172] [ENSMUST00000143172] [ENSMUST00000185459] [ENSMUST00000185459]
Predicted Effect probably null
Transcript: ENSMUST00000034915
SMART Domains Protein: ENSMUSP00000034915
Gene: ENSMUSG00000032359

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Inhibitor_I29 33 88 7.24e-17 SMART
Pept_C1 114 330 7.46e-108 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127842
Predicted Effect probably null
Transcript: ENSMUST00000132718
SMART Domains Protein: ENSMUSP00000117599
Gene: ENSMUSG00000032359

DomainStartEndE-ValueType
Inhibitor_I29 59 114 7.24e-17 SMART
Pfam:Peptidase_C1 140 198 4.4e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000132718
SMART Domains Protein: ENSMUSP00000117599
Gene: ENSMUSG00000032359

DomainStartEndE-ValueType
Inhibitor_I29 59 114 7.24e-17 SMART
Pfam:Peptidase_C1 140 198 4.4e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142750
Predicted Effect probably null
Transcript: ENSMUST00000143172
SMART Domains Protein: ENSMUSP00000114427
Gene: ENSMUSG00000032359

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1cs8a_ 62 118 3e-6 SMART
Blast:Pept_C1 63 119 3e-24 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000143172
SMART Domains Protein: ENSMUSP00000114427
Gene: ENSMUSG00000032359

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1cs8a_ 62 118 3e-6 SMART
Blast:Pept_C1 63 119 3e-24 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000185459
SMART Domains Protein: ENSMUSP00000140437
Gene: ENSMUSG00000032359

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Inhibitor_I29 30 85 5.3e-21 SMART
Pept_C1 85 291 9.4e-87 SMART
Predicted Effect probably null
Transcript: ENSMUST00000185459
SMART Domains Protein: ENSMUSP00000140437
Gene: ENSMUSG00000032359

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Inhibitor_I29 30 85 5.3e-21 SMART
Pept_C1 85 291 9.4e-87 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190338
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase C1 (papain) family of cysteine proteases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate multiple protein products. These products include the cathepsin H mini, heavy, and light chains. In rat and human, these three chains can associate to form the mature enzyme, which has both aminopeptidase and endopeptidase activities. Homozygous knockout mice for this gene exhibit impaired lung surfactant processing and reduced tumorigenesis in a pancreatic cancer model. Multiple pseudogenes of this gene have been identified in the genome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a reporter allele exhibit impaired lung surfactant and an abnormal eye globe with elongated axial length. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Allc A T 12: 28,555,306 N331K probably benign Het
Anapc1 G T 2: 128,675,701 S341* probably null Het
Cacna1e T C 1: 154,443,937 E1339G probably damaging Het
Cacna2d1 T A 5: 16,352,678 I702N probably damaging Het
Casp2 C A 6: 42,269,334 H209N probably benign Het
Casr A G 16: 36,510,030 V314A probably benign Het
Ccne2 A T 4: 11,201,353 R294* probably null Het
Cd180 T A 13: 102,704,834 H129Q probably benign Het
Chst10 A T 1: 38,865,527 Y362N probably damaging Het
Ctnna1 T A 18: 35,239,520 D509E probably benign Het
Dhx29 C T 13: 112,944,539 A369V possibly damaging Het
Enox1 A G 14: 77,592,974 T340A probably benign Het
Fam135b T A 15: 71,446,043 T1357S probably benign Het
Flt3 A T 5: 147,355,083 S544T possibly damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Gsap A T 5: 21,290,544 Y831F possibly damaging Het
Hnrnpr C T 4: 136,319,434 T142M probably damaging Het
Jak3 A G 8: 71,678,773 D94G probably benign Het
Ktn1 A T 14: 47,690,920 E579D probably damaging Het
Lama2 G A 10: 27,041,189 P2247S possibly damaging Het
Lrba C T 3: 86,542,641 S2089F probably damaging Het
Map1b C T 13: 99,429,338 V2292M unknown Het
Mphosph10 A T 7: 64,389,445 probably null Het
Pappa C T 4: 65,205,152 T908M probably benign Het
Pdcd10 T A 3: 75,521,057 K150* probably null Het
Piezo2 A T 18: 63,027,864 I2275N probably damaging Het
Pmvk T C 3: 89,467,682 probably null Het
Pold2 G A 11: 5,873,048 P376S probably damaging Het
Prtg A T 9: 72,891,965 Q759L probably damaging Het
Rad51ap1 C T 6: 126,928,227 S107N probably damaging Het
Rfk T A 19: 17,395,202 N29K probably damaging Het
Ror2 T C 13: 53,117,339 M315V probably benign Het
Rrn3 A G 16: 13,813,100 E600G probably benign Het
Ryk A G 9: 102,906,954 Y593C possibly damaging Het
Slc30a3 T A 5: 31,088,660 D193V probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Srbd1 C A 17: 86,119,942 C421F possibly damaging Het
Sstr5 A C 17: 25,492,069 V62G probably damaging Het
Tfip11 G A 5: 112,334,325 W483* probably null Het
Tlk1 T C 2: 70,721,668 H553R probably benign Het
Tnc T C 4: 64,013,925 probably null Het
Trav12-1 A G 14: 53,538,473 T27A probably damaging Het
Usp9y G A Y: 1,364,714 T1033I probably benign Het
V1ra8 C T 6: 90,203,204 H130Y probably benign Het
Vmn2r77 A T 7: 86,802,063 M386L probably benign Het
Other mutations in Ctsh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Ctsh APN 9 90064238 missense probably damaging 1.00
IGL01875:Ctsh APN 9 90064207 missense probably damaging 1.00
IGL02008:Ctsh APN 9 90061547 missense probably damaging 1.00
R0336:Ctsh UTSW 9 90075738 missense probably damaging 1.00
R0632:Ctsh UTSW 9 90061582 missense possibly damaging 0.82
R1488:Ctsh UTSW 9 90071891 missense possibly damaging 0.89
R1847:Ctsh UTSW 9 90061565 missense probably benign 0.04
R3613:Ctsh UTSW 9 90075710 missense probably damaging 1.00
R4270:Ctsh UTSW 9 90061598 missense probably damaging 0.99
R4860:Ctsh UTSW 9 90054548 missense probably benign 0.01
R5187:Ctsh UTSW 9 90054590 missense probably damaging 1.00
R5900:Ctsh UTSW 9 90064568 missense probably damaging 1.00
R5937:Ctsh UTSW 9 90061456 missense probably benign
R6303:Ctsh UTSW 9 90062743 missense possibly damaging 0.83
R6657:Ctsh UTSW 9 90060502 missense probably benign 0.30
R6905:Ctsh UTSW 9 90062766 missense probably damaging 1.00
R6985:Ctsh UTSW 9 90054604 missense possibly damaging 0.90
R7171:Ctsh UTSW 9 90067101 missense probably benign
R7342:Ctsh UTSW 9 90074987 missense probably benign
R7819:Ctsh UTSW 9 90060503 missense possibly damaging 0.71
R7884:Ctsh UTSW 9 90061423 missense probably benign
R8099:Ctsh UTSW 9 90064247 missense probably damaging 1.00
R8294:Ctsh UTSW 9 90068436 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- GAGTCTGAGTTCCTTTTCGAAC -3'
(R):5'- GGGCAGCACTATTTGGAAGG -3'

Sequencing Primer
(F):5'- AGACTACCGAGTGAGACTCTGTC -3'
(R):5'- AAGGTCACTTCACTGTCTCCTTC -3'
Posted On2016-10-06