Incidental Mutation 'R5469:Pold2'
ID433415
Institutional Source Beutler Lab
Gene Symbol Pold2
Ensembl Gene ENSMUSG00000020471
Gene Namepolymerase (DNA directed), delta 2, regulatory subunit
Synonymsp50, 50kDa, po1D2
MMRRC Submission 043030-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5469 (G1)
Quality Score98
Status Not validated
Chromosome11
Chromosomal Location5872180-5878292 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 5873048 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 376 (P376S)
Ref Sequence ENSEMBL: ENSMUSP00000099986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102922] [ENSMUST00000102923] [ENSMUST00000109829] [ENSMUST00000153995]
Predicted Effect probably damaging
Transcript: ENSMUST00000102922
AA Change: P376S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099986
Gene: ENSMUSG00000020471
AA Change: P376S

DomainStartEndE-ValueType
Pfam:DNA_pol_E_B 196 412 1e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102923
SMART Domains Protein: ENSMUSP00000099987
Gene: ENSMUSG00000020473

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 46 N/A INTRINSIC
low complexity region 85 102 N/A INTRINSIC
low complexity region 113 159 N/A INTRINSIC
low complexity region 217 229 N/A INTRINSIC
low complexity region 264 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
FA58C 375 531 8.72e-46 SMART
Zn_pept 555 983 5.56e-43 SMART
low complexity region 1005 1029 N/A INTRINSIC
low complexity region 1035 1052 N/A INTRINSIC
low complexity region 1069 1089 N/A INTRINSIC
low complexity region 1092 1106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109829
SMART Domains Protein: ENSMUSP00000105454
Gene: ENSMUSG00000020473

DomainStartEndE-ValueType
FA58C 1 151 2.04e-37 SMART
Zn_pept 175 603 5.56e-43 SMART
low complexity region 625 649 N/A INTRINSIC
low complexity region 655 672 N/A INTRINSIC
low complexity region 689 709 N/A INTRINSIC
low complexity region 712 726 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134957
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141907
Predicted Effect probably benign
Transcript: ENSMUST00000153995
SMART Domains Protein: ENSMUSP00000122906
Gene: ENSMUSG00000020471

DomainStartEndE-ValueType
PDB:3E0J|G 1 241 1e-142 PDB
Meta Mutation Damage Score 0.9595 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the 50-kDa catalytic subunit of DNA polymerase delta. DNA polymerase delta possesses both polymerase and 3' to 5' exonuclease activity and plays a critical role in DNA replication and repair. The encoded protein is required for the stimulation of DNA polymerase delta activity by the processivity cofactor proliferating cell nuclear antigen (PCNA). Expression of this gene may be a marker for ovarian carcinomas. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 5. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Allc A T 12: 28,555,306 N331K probably benign Het
Anapc1 G T 2: 128,675,701 S341* probably null Het
Cacna1e T C 1: 154,443,937 E1339G probably damaging Het
Cacna2d1 T A 5: 16,352,678 I702N probably damaging Het
Casp2 C A 6: 42,269,334 H209N probably benign Het
Casr A G 16: 36,510,030 V314A probably benign Het
Ccne2 A T 4: 11,201,353 R294* probably null Het
Cd180 T A 13: 102,704,834 H129Q probably benign Het
Chst10 A T 1: 38,865,527 Y362N probably damaging Het
Ctnna1 T A 18: 35,239,520 D509E probably benign Het
Ctsh G T 9: 90,060,511 probably null Het
Dhx29 C T 13: 112,944,539 A369V possibly damaging Het
Enox1 A G 14: 77,592,974 T340A probably benign Het
Fam135b T A 15: 71,446,043 T1357S probably benign Het
Flt3 A T 5: 147,355,083 S544T possibly damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Gsap A T 5: 21,290,544 Y831F possibly damaging Het
Hnrnpr C T 4: 136,319,434 T142M probably damaging Het
Jak3 A G 8: 71,678,773 D94G probably benign Het
Ktn1 A T 14: 47,690,920 E579D probably damaging Het
Lama2 G A 10: 27,041,189 P2247S possibly damaging Het
Lrba C T 3: 86,542,641 S2089F probably damaging Het
Map1b C T 13: 99,429,338 V2292M unknown Het
Mphosph10 A T 7: 64,389,445 probably null Het
Pappa C T 4: 65,205,152 T908M probably benign Het
Pdcd10 T A 3: 75,521,057 K150* probably null Het
Piezo2 A T 18: 63,027,864 I2275N probably damaging Het
Pmvk T C 3: 89,467,682 probably null Het
Prtg A T 9: 72,891,965 Q759L probably damaging Het
Rad51ap1 C T 6: 126,928,227 S107N probably damaging Het
Rfk T A 19: 17,395,202 N29K probably damaging Het
Ror2 T C 13: 53,117,339 M315V probably benign Het
Rrn3 A G 16: 13,813,100 E600G probably benign Het
Ryk A G 9: 102,906,954 Y593C possibly damaging Het
Slc30a3 T A 5: 31,088,660 D193V probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Srbd1 C A 17: 86,119,942 C421F possibly damaging Het
Sstr5 A C 17: 25,492,069 V62G probably damaging Het
Tfip11 G A 5: 112,334,325 W483* probably null Het
Tlk1 T C 2: 70,721,668 H553R probably benign Het
Tnc T C 4: 64,013,925 probably null Het
Trav12-1 A G 14: 53,538,473 T27A probably damaging Het
Usp9y G A Y: 1,364,714 T1033I probably benign Het
V1ra8 C T 6: 90,203,204 H130Y probably benign Het
Vmn2r77 A T 7: 86,802,063 M386L probably benign Het
Other mutations in Pold2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Pold2 APN 11 5872412 missense probably benign 0.00
IGL00784:Pold2 APN 11 5872412 missense probably benign 0.00
IGL01014:Pold2 APN 11 5872293 missense probably benign
R0056:Pold2 UTSW 11 5872338 missense possibly damaging 0.82
R0111:Pold2 UTSW 11 5876760 missense probably damaging 1.00
R0392:Pold2 UTSW 11 5876776 missense possibly damaging 0.57
R1023:Pold2 UTSW 11 5875140 missense probably benign 0.01
R1496:Pold2 UTSW 11 5874175 missense possibly damaging 0.91
R1521:Pold2 UTSW 11 5876833 missense probably damaging 0.99
R1835:Pold2 UTSW 11 5873454 missense possibly damaging 0.56
R1836:Pold2 UTSW 11 5873454 missense possibly damaging 0.56
R2032:Pold2 UTSW 11 5876757 missense probably benign
R2055:Pold2 UTSW 11 5873516 nonsense probably null
R5288:Pold2 UTSW 11 5876760 missense probably damaging 1.00
R5384:Pold2 UTSW 11 5876760 missense probably damaging 1.00
R5385:Pold2 UTSW 11 5876760 missense probably damaging 1.00
R5470:Pold2 UTSW 11 5873048 missense probably damaging 1.00
R6232:Pold2 UTSW 11 5873691 missense probably benign 0.03
R7147:Pold2 UTSW 11 5873095 missense probably benign 0.41
R7886:Pold2 UTSW 11 5872714 missense probably damaging 1.00
R8147:Pold2 UTSW 11 5876842 missense probably benign
R8353:Pold2 UTSW 11 5875104 missense probably damaging 0.99
R8453:Pold2 UTSW 11 5875104 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCTGTATGCCCCTAGTCTG -3'
(R):5'- ATCAGGTGGGATCTCAGATAGTC -3'

Sequencing Primer
(F):5'- GTATGCCCCTAGTCTGTATGGTAC -3'
(R):5'- ATCTCAGATAGTCTATGTAGGTGGG -3'
Posted On2016-10-06