Mutagenetix > Incidental Mutations

Incidental Mutation 'R5469:Ror2'

433418

Institutional Source

Beutler Lab

Gene Symbol

Ror2

Ensembl Gene

ENSMUSG00000021464

Gene Name

receptor tyrosine kinase-like orphan receptor 2

Synonyms

Ntrkr2

MMRRC Submission

043030-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5469 (G1)

Quality Score

120

Status

Not validated

Chromosome

Chromosomal Location

53109312-53286124 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 53117339 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 315 (M315V)

Ref Sequence

ENSEMBL: ENSMUSP00000123362 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021918] [ENSMUST00000130235]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000021918
AA Change: M327V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000021918
Gene: ENSMUSG00000021464
AA Change: M327V

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
IGc2	74	142	5.23e-16	SMART
Pfam:Fz	174	294	1.2e-12	PFAM
KR	314	396	3.94e-45	SMART
transmembrane domain	403	425	N/A	INTRINSIC
TyrKc	473	746	1.96e-113	SMART
low complexity region	765	783	N/A	INTRINSIC
low complexity region	788	801	N/A	INTRINSIC
low complexity region	839	859	N/A	INTRINSIC
low complexity region	860	872	N/A	INTRINSIC
low complexity region	905	924	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000130235
AA Change: M315V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000123362
Gene: ENSMUSG00000021464
AA Change: M315V

Domain	Start	End	E-Value	Type
IGc2	62	130	5.23e-16	SMART
Pfam:Fz	162	289	3.2e-26	PFAM
KR	302	384	3.94e-45	SMART
transmembrane domain	391	413	N/A	INTRINSIC
TyrKc	461	734	1.96e-113	SMART
low complexity region	753	771	N/A	INTRINSIC
low complexity region	776	789	N/A	INTRINSIC
low complexity region	827	847	N/A	INTRINSIC
low complexity region	848	860	N/A	INTRINSIC
low complexity region	893	912	N/A	INTRINSIC

Coding Region Coverage

1x: 98.2%
3x: 97.3%
10x: 95.1%
20x: 90.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor protein tyrosine kinase and type I transmembrane protein that belongs to the ROR subfamily of cell surface receptors. The protein may be involved in the early formation of the chondrocytes and may be required for cartilage and growth plate development. Mutations in this gene can cause brachydactyly type B, a skeletal disorder characterized by hypoplasia/aplasia of distal phalanges and nails. In addition, mutations in this gene can cause the autosomal recessive form of Robinow syndrome, which is characterized by skeletal dysplasia with generalized limb bone shortening, segmental defects of the spine, brachydactyly, and a dysmorphic facial appearance. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first few hours after birth. They display respiratory and cardiovascular abnormalities as well as a variety of skeletal defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Allc	A	T	12: 28,555,306	N331K	probably benign	Het
Anapc1	G	T	2: 128,675,701	S341*	probably null	Het
Cacna1e	T	C	1: 154,443,937	E1339G	probably damaging	Het
Cacna2d1	T	A	5: 16,352,678	I702N	probably damaging	Het
Casp2	C	A	6: 42,269,334	H209N	probably benign	Het
Casr	A	G	16: 36,510,030	V314A	probably benign	Het
Ccne2	A	T	4: 11,201,353	R294*	probably null	Het
Cd180	T	A	13: 102,704,834	H129Q	probably benign	Het
Chst10	A	T	1: 38,865,527	Y362N	probably damaging	Het
Ctnna1	T	A	18: 35,239,520	D509E	probably benign	Het
Ctsh	G	T	9: 90,060,511		probably null	Het
Dhx29	C	T	13: 112,944,539	A369V	possibly damaging	Het
Enox1	A	G	14: 77,592,974	T340A	probably benign	Het
Fam135b	T	A	15: 71,446,043	T1357S	probably benign	Het
Flt3	A	T	5: 147,355,083	S544T	possibly damaging	Het
Gm12689	T	C	4: 99,296,165	I85T	unknown	Het
Gsap	A	T	5: 21,290,544	Y831F	possibly damaging	Het
Hnrnpr	C	T	4: 136,319,434	T142M	probably damaging	Het
Jak3	A	G	8: 71,678,773	D94G	probably benign	Het
Ktn1	A	T	14: 47,690,920	E579D	probably damaging	Het
Lama2	G	A	10: 27,041,189	P2247S	possibly damaging	Het
Lrba	C	T	3: 86,542,641	S2089F	probably damaging	Het
Map1b	C	T	13: 99,429,338	V2292M	unknown	Het
Mphosph10	A	T	7: 64,389,445		probably null	Het
Pappa	C	T	4: 65,205,152	T908M	probably benign	Het
Pdcd10	T	A	3: 75,521,057	K150*	probably null	Het
Piezo2	A	T	18: 63,027,864	I2275N	probably damaging	Het
Pmvk	T	C	3: 89,467,682		probably null	Het
Pold2	G	A	11: 5,873,048	P376S	probably damaging	Het
Prtg	A	T	9: 72,891,965	Q759L	probably damaging	Het
Rad51ap1	C	T	6: 126,928,227	S107N	probably damaging	Het
Rfk	T	A	19: 17,395,202	N29K	probably damaging	Het
Rrn3	A	G	16: 13,813,100	E600G	probably benign	Het
Ryk	A	G	9: 102,906,954	Y593C	possibly damaging	Het
Slc30a3	T	A	5: 31,088,660	D193V	probably damaging	Het
Slc35e2	C	T	4: 155,610,026	P10L	probably benign	Het
Srbd1	C	A	17: 86,119,942	C421F	possibly damaging	Het
Sstr5	A	C	17: 25,492,069	V62G	probably damaging	Het
Tfip11	G	A	5: 112,334,325	W483*	probably null	Het
Tlk1	T	C	2: 70,721,668	H553R	probably benign	Het
Tnc	T	C	4: 64,013,925		probably null	Het
Trav12-1	A	G	14: 53,538,473	T27A	probably damaging	Het
Usp9y	G	A	Y: 1,364,714	T1033I	probably benign	Het
V1ra8	C	T	6: 90,203,204	H130Y	probably benign	Het
Vmn2r77	A	T	7: 86,802,063	M386L	probably benign	Het

Other mutations in Ror2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Ror2	APN	13	53113082	missense	probably benign	0.01
IGL01523:Ror2	APN	13	53118963	missense	probably benign	0.02
IGL01599:Ror2	APN	13	53111617	missense	probably damaging	1.00
IGL01669:Ror2	APN	13	53111088	missense	probably damaging	1.00
IGL02016:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02138:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02139:Ror2	APN	13	53111164	missense	probably damaging	1.00
IGL02172:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02173:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02176:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02177:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02178:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02179:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02182:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02189:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02190:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02203:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02230:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02231:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02234:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02423:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02424:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02478:Ror2	APN	13	53121667	missense	probably damaging	1.00
IGL02479:Ror2	APN	13	53131932	missense	possibly damaging	0.62
IGL02517:Ror2	APN	13	53118840	missense	probably damaging	1.00
IGL02554:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02618:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02619:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02622:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02623:Ror2	APN	13	53110728	missense	probably damaging	1.00
lavage	UTSW	13	53118982	missense	probably damaging	1.00
tendrils	UTSW	13	53111451	missense	probably damaging	0.96
willowy	UTSW	13	53131919	missense	probably damaging	1.00
R0076:Ror2	UTSW	13	53113074	missense	probably benign	0.02
R0375:Ror2	UTSW	13	53132004	missense	probably damaging	1.00
R0826:Ror2	UTSW	13	53113217	missense	probably damaging	1.00
R1823:Ror2	UTSW	13	53110305	missense	probably benign	0.07
R1895:Ror2	UTSW	13	53131849	missense	probably damaging	1.00
R1946:Ror2	UTSW	13	53131849	missense	probably damaging	1.00
R1983:Ror2	UTSW	13	53110408	missense	probably benign	0.01
R2031:Ror2	UTSW	13	53117330	missense	probably benign	0.01
R2197:Ror2	UTSW	13	53285780	critical splice donor site	probably null
R2246:Ror2	UTSW	13	53111602	missense	probably damaging	1.00
R2405:Ror2	UTSW	13	53130944	missense	possibly damaging	0.67
R2411:Ror2	UTSW	13	53130944	missense	possibly damaging	0.67
R2905:Ror2	UTSW	13	53131995	missense	probably benign	0.01
R3156:Ror2	UTSW	13	53117364	missense	probably damaging	0.98
R4198:Ror2	UTSW	13	53110644	missense	probably benign	0.08
R4408:Ror2	UTSW	13	53118961	missense	probably damaging	1.00
R4469:Ror2	UTSW	13	53131980	missense	possibly damaging	0.87
R4648:Ror2	UTSW	13	53285500	nonsense	probably null
R4705:Ror2	UTSW	13	53117297	missense	probably benign	0.00
R4824:Ror2	UTSW	13	53110683	missense	probably benign	0.10
R4831:Ror2	UTSW	13	53118844	missense	probably damaging	0.97
R4951:Ror2	UTSW	13	53117147	missense	probably benign	0.00
R4975:Ror2	UTSW	13	53131918	missense	probably damaging	1.00
R5380:Ror2	UTSW	13	53117149	missense	possibly damaging	0.73
R5604:Ror2	UTSW	13	53117165	missense	probably benign	0.01
R6188:Ror2	UTSW	13	53111311	missense	probably damaging	0.98
R6221:Ror2	UTSW	13	53113217	missense	probably damaging	1.00
R6243:Ror2	UTSW	13	53113080	missense	probably benign
R6255:Ror2	UTSW	13	53110542	missense	probably damaging	1.00
R6497:Ror2	UTSW	13	53131919	missense	probably damaging	1.00
R6717:Ror2	UTSW	13	53118982	missense	probably damaging	1.00
R6918:Ror2	UTSW	13	53111451	missense	probably damaging	0.96
R7092:Ror2	UTSW	13	53110236	missense	probably benign
R7134:Ror2	UTSW	13	53146706	missense	probably benign	0.00
R7254:Ror2	UTSW	13	53118720	missense	possibly damaging	0.72
R7517:Ror2	UTSW	13	53110865	missense	possibly damaging	0.86
R7560:Ror2	UTSW	13	53110813	missense	probably benign	0.05
R7746:Ror2	UTSW	13	53117225	missense	probably damaging	1.00
R8031:Ror2	UTSW	13	53113157	missense	probably damaging	1.00
R8479:Ror2	UTSW	13	53117364	missense	probably damaging	0.98
R8684:Ror2	UTSW	13	53110266	missense	possibly damaging	0.90
R8834:Ror2	UTSW	13	53110302	small deletion	probably benign
R8948:Ror2	UTSW	13	53131996	missense	possibly damaging	0.67
R9233:Ror2	UTSW	13	53111554	missense	probably benign
R9234:Ror2	UTSW	13	53111338	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACGTCACACAGTTCCACGC -3'
(R):5'- GGATTCAGTCCCTCTAATGCTACC -3'

Sequencing Primer
(F):5'- CGCGTACGTTTTTATTCTGCGTAAAG -3'
(R):5'- TCAGGTCACATGTAAAACCCTTAGG -3'

Posted On

2016-10-06