Incidental Mutation 'R5469:Ktn1'
ID433423
Institutional Source Beutler Lab
Gene Symbol Ktn1
Ensembl Gene ENSMUSG00000021843
Gene Namekinectin 1
Synonyms
MMRRC Submission 043030-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5469 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location47648448-47739894 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 47690920 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 579 (E579D)
Ref Sequence ENSEMBL: ENSMUSP00000140865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022391] [ENSMUST00000185343] [ENSMUST00000185940] [ENSMUST00000186627] [ENSMUST00000186761] [ENSMUST00000187039] [ENSMUST00000187262] [ENSMUST00000187839] [ENSMUST00000188330] [ENSMUST00000188553] [ENSMUST00000189101] [ENSMUST00000189533] [ENSMUST00000189986] [ENSMUST00000190182] [ENSMUST00000190252] [ENSMUST00000190535] [ENSMUST00000190999] [ENSMUST00000191018] [ENSMUST00000191446] [ENSMUST00000191511]
Predicted Effect probably damaging
Transcript: ENSMUST00000022391
AA Change: E579D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022391
Gene: ENSMUSG00000021843
AA Change: E579D

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1028 N/A INTRINSIC
coiled coil region 1089 1267 N/A INTRINSIC
coiled coil region 1302 1326 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000185343
AA Change: E579D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140186
Gene: ENSMUSG00000021843
AA Change: E579D

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 1005 N/A INTRINSIC
coiled coil region 1066 1192 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000185940
AA Change: E579D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139625
Gene: ENSMUSG00000021843
AA Change: E579D

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1163 N/A INTRINSIC
coiled coil region 1198 1222 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186627
AA Change: E579D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140873
Gene: ENSMUSG00000021843
AA Change: E579D

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1191 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186761
AA Change: E579D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139521
Gene: ENSMUSG00000021843
AA Change: E579D

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1016 N/A INTRINSIC
coiled coil region 1060 1210 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187039
AA Change: E579D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140202
Gene: ENSMUSG00000021843
AA Change: E579D

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1163 N/A INTRINSIC
coiled coil region 1198 1222 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187262
AA Change: E579D

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140206
Gene: ENSMUSG00000021843
AA Change: E579D

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1028 N/A INTRINSIC
coiled coil region 1089 1215 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187839
AA Change: E579D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140324
Gene: ENSMUSG00000021843
AA Change: E579D

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1028 N/A INTRINSIC
coiled coil region 1089 1267 N/A INTRINSIC
coiled coil region 1302 1326 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188330
AA Change: E579D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140845
Gene: ENSMUSG00000021843
AA Change: E579D

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1187 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188553
AA Change: E579D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140865
Gene: ENSMUSG00000021843
AA Change: E579D

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 1005 N/A INTRINSIC
coiled coil region 1066 1216 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189101
AA Change: E579D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140178
Gene: ENSMUSG00000021843
AA Change: E579D

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1163 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189533
AA Change: E579D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140142
Gene: ENSMUSG00000021843
AA Change: E579D

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1187 N/A INTRINSIC
coiled coil region 1222 1246 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189986
SMART Domains Protein: ENSMUSP00000139970
Gene: ENSMUSG00000021843

DomainStartEndE-ValueType
Pfam:Rib_recp_KP_reg 29 172 2.1e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000190182
AA Change: E579D

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140301
Gene: ENSMUSG00000021843
AA Change: E579D

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1016 N/A INTRINSIC
coiled coil region 1060 1238 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190252
AA Change: E579D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140011
Gene: ENSMUSG00000021843
AA Change: E579D

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1016 N/A INTRINSIC
coiled coil region 1060 1210 N/A INTRINSIC
coiled coil region 1245 1269 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190535
AA Change: E579D

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139952
Gene: ENSMUSG00000021843
AA Change: E579D

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 1005 N/A INTRINSIC
coiled coil region 1066 1244 N/A INTRINSIC
coiled coil region 1279 1303 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190999
AA Change: E579D

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139673
Gene: ENSMUSG00000021843
AA Change: E579D

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1215 N/A INTRINSIC
coiled coil region 1250 1274 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191018
AA Change: E579D

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139585
Gene: ENSMUSG00000021843
AA Change: E579D

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 1005 N/A INTRINSIC
coiled coil region 1066 1220 N/A INTRINSIC
coiled coil region 1255 1279 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191446
AA Change: E579D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140748
Gene: ENSMUSG00000021843
AA Change: E579D

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1028 N/A INTRINSIC
coiled coil region 1089 1215 N/A INTRINSIC
coiled coil region 1250 1274 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191511
AA Change: E579D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139946
Gene: ENSMUSG00000021843
AA Change: E579D

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 1005 N/A INTRINSIC
coiled coil region 1066 1192 N/A INTRINSIC
coiled coil region 1227 1251 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation or a floxed allele exhibit no discernable phenotype; mice are viable and fertile up to one year of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Allc A T 12: 28,555,306 N331K probably benign Het
Anapc1 G T 2: 128,675,701 S341* probably null Het
Cacna1e T C 1: 154,443,937 E1339G probably damaging Het
Cacna2d1 T A 5: 16,352,678 I702N probably damaging Het
Casp2 C A 6: 42,269,334 H209N probably benign Het
Casr A G 16: 36,510,030 V314A probably benign Het
Ccne2 A T 4: 11,201,353 R294* probably null Het
Cd180 T A 13: 102,704,834 H129Q probably benign Het
Chst10 A T 1: 38,865,527 Y362N probably damaging Het
Ctnna1 T A 18: 35,239,520 D509E probably benign Het
Ctsh G T 9: 90,060,511 probably null Het
Dhx29 C T 13: 112,944,539 A369V possibly damaging Het
Enox1 A G 14: 77,592,974 T340A probably benign Het
Fam135b T A 15: 71,446,043 T1357S probably benign Het
Flt3 A T 5: 147,355,083 S544T possibly damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Gsap A T 5: 21,290,544 Y831F possibly damaging Het
Hnrnpr C T 4: 136,319,434 T142M probably damaging Het
Jak3 A G 8: 71,678,773 D94G probably benign Het
Lama2 G A 10: 27,041,189 P2247S possibly damaging Het
Lrba C T 3: 86,542,641 S2089F probably damaging Het
Map1b C T 13: 99,429,338 V2292M unknown Het
Mphosph10 A T 7: 64,389,445 probably null Het
Pappa C T 4: 65,205,152 T908M probably benign Het
Pdcd10 T A 3: 75,521,057 K150* probably null Het
Piezo2 A T 18: 63,027,864 I2275N probably damaging Het
Pmvk T C 3: 89,467,682 probably null Het
Pold2 G A 11: 5,873,048 P376S probably damaging Het
Prtg A T 9: 72,891,965 Q759L probably damaging Het
Rad51ap1 C T 6: 126,928,227 S107N probably damaging Het
Rfk T A 19: 17,395,202 N29K probably damaging Het
Ror2 T C 13: 53,117,339 M315V probably benign Het
Rrn3 A G 16: 13,813,100 E600G probably benign Het
Ryk A G 9: 102,906,954 Y593C possibly damaging Het
Slc30a3 T A 5: 31,088,660 D193V probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Srbd1 C A 17: 86,119,942 C421F possibly damaging Het
Sstr5 A C 17: 25,492,069 V62G probably damaging Het
Tfip11 G A 5: 112,334,325 W483* probably null Het
Tlk1 T C 2: 70,721,668 H553R probably benign Het
Tnc T C 4: 64,013,925 probably null Het
Trav12-1 A G 14: 53,538,473 T27A probably damaging Het
Usp9y G A Y: 1,364,714 T1033I probably benign Het
V1ra8 C T 6: 90,203,204 H130Y probably benign Het
Vmn2r77 A T 7: 86,802,063 M386L probably benign Het
Other mutations in Ktn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Ktn1 APN 14 47708878 missense probably benign 0.30
IGL01109:Ktn1 APN 14 47714721 missense probably damaging 1.00
IGL02300:Ktn1 APN 14 47690060 missense probably damaging 1.00
IGL02339:Ktn1 APN 14 47683378 splice site probably benign
IGL02525:Ktn1 APN 14 47724743 critical splice donor site probably null
IGL02565:Ktn1 APN 14 47672934 splice site probably benign
IGL02678:Ktn1 APN 14 47734153 critical splice acceptor site probably null
IGL03181:Ktn1 APN 14 47733284 missense probably benign 0.19
IGL03393:Ktn1 APN 14 47690934 missense probably damaging 1.00
PIT4520001:Ktn1 UTSW 14 47686317 missense probably damaging 0.96
R0035:Ktn1 UTSW 14 47730379 missense probably benign 0.07
R0035:Ktn1 UTSW 14 47730379 missense probably benign 0.07
R0270:Ktn1 UTSW 14 47714662 missense probably benign 0.00
R0370:Ktn1 UTSW 14 47664075 missense probably benign 0.00
R0371:Ktn1 UTSW 14 47724003 nonsense probably null
R0530:Ktn1 UTSW 14 47733243 missense probably benign 0.14
R0531:Ktn1 UTSW 14 47663941 missense probably damaging 0.98
R0611:Ktn1 UTSW 14 47694616 missense probably benign
R0836:Ktn1 UTSW 14 47701062 splice site probably null
R1076:Ktn1 UTSW 14 47694638 missense probably damaging 0.99
R1522:Ktn1 UTSW 14 47667416 missense probably damaging 1.00
R1554:Ktn1 UTSW 14 47695507 missense probably damaging 1.00
R1992:Ktn1 UTSW 14 47695521 missense probably damaging 1.00
R2040:Ktn1 UTSW 14 47700612 splice site probably benign
R2080:Ktn1 UTSW 14 47725960 missense probably damaging 1.00
R2110:Ktn1 UTSW 14 47693888 missense possibly damaging 0.47
R2144:Ktn1 UTSW 14 47714652 missense probably damaging 1.00
R3730:Ktn1 UTSW 14 47701149 missense probably damaging 1.00
R3780:Ktn1 UTSW 14 47706403 splice site probably benign
R3782:Ktn1 UTSW 14 47706403 splice site probably benign
R4414:Ktn1 UTSW 14 47724930 nonsense probably null
R4610:Ktn1 UTSW 14 47726179 intron probably benign
R4784:Ktn1 UTSW 14 47693496 critical splice donor site probably null
R4838:Ktn1 UTSW 14 47725956 nonsense probably null
R4909:Ktn1 UTSW 14 47706460 missense probably damaging 0.99
R4976:Ktn1 UTSW 14 47670299 critical splice donor site probably null
R5110:Ktn1 UTSW 14 47704287 splice site probably benign
R5257:Ktn1 UTSW 14 47667363 missense probably benign 0.05
R5600:Ktn1 UTSW 14 47690033 missense probably damaging 1.00
R5607:Ktn1 UTSW 14 47734097 intron probably benign
R5608:Ktn1 UTSW 14 47734097 intron probably benign
R5920:Ktn1 UTSW 14 47724024 nonsense probably null
R6045:Ktn1 UTSW 14 47676796 missense probably damaging 1.00
R6139:Ktn1 UTSW 14 47726215 splice site probably null
R6282:Ktn1 UTSW 14 47663971 missense probably damaging 1.00
R6654:Ktn1 UTSW 14 47690000 missense probably damaging 1.00
R6957:Ktn1 UTSW 14 47667353 nonsense probably null
R6959:Ktn1 UTSW 14 47720256 missense probably damaging 1.00
R7170:Ktn1 UTSW 14 47706410 missense probably damaging 1.00
R7206:Ktn1 UTSW 14 47695528 missense probably damaging 0.97
R7442:Ktn1 UTSW 14 47714640 missense probably benign 0.01
R7462:Ktn1 UTSW 14 47694632 missense probably null 1.00
R7513:Ktn1 UTSW 14 47664084 missense possibly damaging 0.77
R7743:Ktn1 UTSW 14 47670293 missense probably damaging 1.00
R8010:Ktn1 UTSW 14 47705773 missense possibly damaging 0.60
R8062:Ktn1 UTSW 14 47724972 critical splice donor site probably null
R8244:Ktn1 UTSW 14 47674823 missense probably null 1.00
Z1177:Ktn1 UTSW 14 47692438 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGCTCATCCACTTCCTTAGGAC -3'
(R):5'- AACTGACTCATTGACTAGTCTCCC -3'

Sequencing Primer
(F):5'- GACAGTAAACCAGCCTTGATGTCTG -3'
(R):5'- AGTCTCCCAACTACTGAAGTTTGG -3'
Posted On2016-10-06