Incidental Mutation 'R5469:Enox1'
ID433426
Institutional Source Beutler Lab
Gene Symbol Enox1
Ensembl Gene ENSMUSG00000022012
Gene Nameecto-NOX disulfide-thiol exchanger 1
SynonymsD230005D02Rik
MMRRC Submission 043030-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5469 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location77156763-77721760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77592974 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 340 (T340A)
Ref Sequence ENSEMBL: ENSMUSP00000154296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022589] [ENSMUST00000227662] [ENSMUST00000227831]
Predicted Effect probably benign
Transcript: ENSMUST00000022589
AA Change: T340A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022589
Gene: ENSMUSG00000022012
AA Change: T340A

DomainStartEndE-ValueType
low complexity region 95 105 N/A INTRINSIC
RRM 143 209 2.41e-8 SMART
low complexity region 233 251 N/A INTRINSIC
coiled coil region 307 342 N/A INTRINSIC
low complexity region 395 406 N/A INTRINSIC
coiled coil region 425 527 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227098
Predicted Effect probably benign
Transcript: ENSMUST00000227662
AA Change: T340A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000227831
AA Change: T340A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228102
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in plasma membrane electron transport pathways. The encoded protein has both a hydroquinone (NADH) oxidase activity and a protein disulfide-thiol interchange activity. The two activities cycle with a periodicity of 24 minutes, with one activity being at its peak when the other is at its lowest. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Allc A T 12: 28,555,306 N331K probably benign Het
Anapc1 G T 2: 128,675,701 S341* probably null Het
Cacna1e T C 1: 154,443,937 E1339G probably damaging Het
Cacna2d1 T A 5: 16,352,678 I702N probably damaging Het
Casp2 C A 6: 42,269,334 H209N probably benign Het
Casr A G 16: 36,510,030 V314A probably benign Het
Ccne2 A T 4: 11,201,353 R294* probably null Het
Cd180 T A 13: 102,704,834 H129Q probably benign Het
Chst10 A T 1: 38,865,527 Y362N probably damaging Het
Ctnna1 T A 18: 35,239,520 D509E probably benign Het
Ctsh G T 9: 90,060,511 probably null Het
Dhx29 C T 13: 112,944,539 A369V possibly damaging Het
Fam135b T A 15: 71,446,043 T1357S probably benign Het
Flt3 A T 5: 147,355,083 S544T possibly damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Gsap A T 5: 21,290,544 Y831F possibly damaging Het
Hnrnpr C T 4: 136,319,434 T142M probably damaging Het
Jak3 A G 8: 71,678,773 D94G probably benign Het
Ktn1 A T 14: 47,690,920 E579D probably damaging Het
Lama2 G A 10: 27,041,189 P2247S possibly damaging Het
Lrba C T 3: 86,542,641 S2089F probably damaging Het
Map1b C T 13: 99,429,338 V2292M unknown Het
Mphosph10 A T 7: 64,389,445 probably null Het
Pappa C T 4: 65,205,152 T908M probably benign Het
Pdcd10 T A 3: 75,521,057 K150* probably null Het
Piezo2 A T 18: 63,027,864 I2275N probably damaging Het
Pmvk T C 3: 89,467,682 probably null Het
Pold2 G A 11: 5,873,048 P376S probably damaging Het
Prtg A T 9: 72,891,965 Q759L probably damaging Het
Rad51ap1 C T 6: 126,928,227 S107N probably damaging Het
Rfk T A 19: 17,395,202 N29K probably damaging Het
Ror2 T C 13: 53,117,339 M315V probably benign Het
Rrn3 A G 16: 13,813,100 E600G probably benign Het
Ryk A G 9: 102,906,954 Y593C possibly damaging Het
Slc30a3 T A 5: 31,088,660 D193V probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Srbd1 C A 17: 86,119,942 C421F possibly damaging Het
Sstr5 A C 17: 25,492,069 V62G probably damaging Het
Tfip11 G A 5: 112,334,325 W483* probably null Het
Tlk1 T C 2: 70,721,668 H553R probably benign Het
Tnc T C 4: 64,013,925 probably null Het
Trav12-1 A G 14: 53,538,473 T27A probably damaging Het
Usp9y G A Y: 1,364,714 T1033I probably benign Het
V1ra8 C T 6: 90,203,204 H130Y probably benign Het
Vmn2r77 A T 7: 86,802,063 M386L probably benign Het
Other mutations in Enox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Enox1 APN 14 77582404 missense possibly damaging 0.63
IGL01376:Enox1 APN 14 77251843 intron probably benign
IGL01509:Enox1 APN 14 77699273 missense probably damaging 1.00
IGL01684:Enox1 APN 14 77579093 missense possibly damaging 0.81
IGL01874:Enox1 APN 14 77579162 missense probably damaging 1.00
IGL03324:Enox1 APN 14 77615485 missense probably damaging 1.00
Soft UTSW 14 77486017 intron probably benign
R0037:Enox1 UTSW 14 77699310 splice site probably benign
R0112:Enox1 UTSW 14 77699198 missense possibly damaging 0.77
R0543:Enox1 UTSW 14 77506959 splice site probably benign
R0569:Enox1 UTSW 14 77637677 missense probably damaging 0.99
R0708:Enox1 UTSW 14 77592912 missense probably benign 0.28
R0811:Enox1 UTSW 14 77582436 missense probably damaging 0.99
R0812:Enox1 UTSW 14 77582436 missense probably damaging 0.99
R1417:Enox1 UTSW 14 77486005 intron probably benign
R1654:Enox1 UTSW 14 77611374 missense possibly damaging 0.87
R1678:Enox1 UTSW 14 77577656 missense probably benign 0.00
R1817:Enox1 UTSW 14 77615475 missense possibly damaging 0.84
R1976:Enox1 UTSW 14 77668793 missense probably benign
R2520:Enox1 UTSW 14 77582399 missense probably damaging 0.99
R3880:Enox1 UTSW 14 77611386 missense possibly damaging 0.49
R4096:Enox1 UTSW 14 77577720 missense probably damaging 0.99
R4885:Enox1 UTSW 14 77720850 missense probably damaging 1.00
R4998:Enox1 UTSW 14 77501435 intron probably benign
R5110:Enox1 UTSW 14 77707687 critical splice donor site probably null
R5341:Enox1 UTSW 14 77577656 missense possibly damaging 0.94
R5596:Enox1 UTSW 14 77579053 missense probably benign 0.42
R5833:Enox1 UTSW 14 77506939 missense probably benign 0.01
R5892:Enox1 UTSW 14 77486017 intron probably benign
R6174:Enox1 UTSW 14 77508187 missense possibly damaging 0.93
R6267:Enox1 UTSW 14 77577764 missense probably damaging 1.00
R6867:Enox1 UTSW 14 77699299 critical splice donor site probably null
R7069:Enox1 UTSW 14 77611324 missense probably damaging 0.99
R7219:Enox1 UTSW 14 77720844 missense probably benign 0.15
R7316:Enox1 UTSW 14 77720858 missense probably benign 0.01
R7738:Enox1 UTSW 14 77577780 missense probably damaging 0.99
Z1177:Enox1 UTSW 14 77668747 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCAAGTTCTCTGAGGCTATCAC -3'
(R):5'- AAGTAAGCTCTCAGGGCAGG -3'

Sequencing Primer
(F):5'- TGAGGCTATCACAGTTCTGC -3'
(R):5'- GTGCTCTTCCACATGCCACAG -3'
Posted On2016-10-06