Incidental Mutation 'R5469:Fam135b'
ID433428
Institutional Source Beutler Lab
Gene Symbol Fam135b
Ensembl Gene ENSMUSG00000036800
Gene Namefamily with sequence similarity 135, member B
Synonyms1700010C24Rik, A830008O07Rik
MMRRC Submission 043030-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5469 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location71431609-71727838 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71446043 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 1357 (T1357S)
Ref Sequence ENSEMBL: ENSMUSP00000022953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022953]
Predicted Effect probably benign
Transcript: ENSMUST00000022953
AA Change: T1357S

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000022953
Gene: ENSMUSG00000036800
AA Change: T1357S

DomainStartEndE-ValueType
Pfam:DUF3657 111 172 1.9e-19 PFAM
low complexity region 744 757 N/A INTRINSIC
low complexity region 1124 1130 N/A INTRINSIC
Pfam:DUF676 1132 1328 2.7e-60 PFAM
Pfam:PGAP1 1135 1309 3.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229634
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Allc A T 12: 28,555,306 N331K probably benign Het
Anapc1 G T 2: 128,675,701 S341* probably null Het
Cacna1e T C 1: 154,443,937 E1339G probably damaging Het
Cacna2d1 T A 5: 16,352,678 I702N probably damaging Het
Casp2 C A 6: 42,269,334 H209N probably benign Het
Casr A G 16: 36,510,030 V314A probably benign Het
Ccne2 A T 4: 11,201,353 R294* probably null Het
Cd180 T A 13: 102,704,834 H129Q probably benign Het
Chst10 A T 1: 38,865,527 Y362N probably damaging Het
Ctnna1 T A 18: 35,239,520 D509E probably benign Het
Ctsh G T 9: 90,060,511 probably null Het
Dhx29 C T 13: 112,944,539 A369V possibly damaging Het
Enox1 A G 14: 77,592,974 T340A probably benign Het
Flt3 A T 5: 147,355,083 S544T possibly damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Gsap A T 5: 21,290,544 Y831F possibly damaging Het
Hnrnpr C T 4: 136,319,434 T142M probably damaging Het
Jak3 A G 8: 71,678,773 D94G probably benign Het
Ktn1 A T 14: 47,690,920 E579D probably damaging Het
Lama2 G A 10: 27,041,189 P2247S possibly damaging Het
Lrba C T 3: 86,542,641 S2089F probably damaging Het
Map1b C T 13: 99,429,338 V2292M unknown Het
Mphosph10 A T 7: 64,389,445 probably null Het
Pappa C T 4: 65,205,152 T908M probably benign Het
Pdcd10 T A 3: 75,521,057 K150* probably null Het
Piezo2 A T 18: 63,027,864 I2275N probably damaging Het
Pmvk T C 3: 89,467,682 probably null Het
Pold2 G A 11: 5,873,048 P376S probably damaging Het
Prtg A T 9: 72,891,965 Q759L probably damaging Het
Rad51ap1 C T 6: 126,928,227 S107N probably damaging Het
Rfk T A 19: 17,395,202 N29K probably damaging Het
Ror2 T C 13: 53,117,339 M315V probably benign Het
Rrn3 A G 16: 13,813,100 E600G probably benign Het
Ryk A G 9: 102,906,954 Y593C possibly damaging Het
Slc30a3 T A 5: 31,088,660 D193V probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Srbd1 C A 17: 86,119,942 C421F possibly damaging Het
Sstr5 A C 17: 25,492,069 V62G probably damaging Het
Tfip11 G A 5: 112,334,325 W483* probably null Het
Tlk1 T C 2: 70,721,668 H553R probably benign Het
Tnc T C 4: 64,013,925 probably null Het
Trav12-1 A G 14: 53,538,473 T27A probably damaging Het
Usp9y G A Y: 1,364,714 T1033I probably benign Het
V1ra8 C T 6: 90,203,204 H130Y probably benign Het
Vmn2r77 A T 7: 86,802,063 M386L probably benign Het
Other mutations in Fam135b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Fam135b APN 15 71450494 missense probably damaging 1.00
IGL00565:Fam135b APN 15 71471512 missense probably benign
IGL00645:Fam135b APN 15 71462546 missense probably damaging 1.00
IGL00686:Fam135b APN 15 71462319 missense probably benign 0.00
IGL00857:Fam135b APN 15 71463616 missense probably benign 0.16
IGL01443:Fam135b APN 15 71463364 missense probably benign 0.02
IGL01690:Fam135b APN 15 71456935 missense probably benign 0.19
IGL01920:Fam135b APN 15 71622036 missense possibly damaging 0.94
IGL01987:Fam135b APN 15 71462115 missense probably benign
IGL02154:Fam135b APN 15 71448710 missense probably benign 0.12
IGL03107:Fam135b APN 15 71463561 missense probably benign
IGL03264:Fam135b APN 15 71462788 missense probably benign
IGL03055:Fam135b UTSW 15 71622034 missense possibly damaging 0.51
R0010:Fam135b UTSW 15 71622032 missense probably damaging 1.00
R0010:Fam135b UTSW 15 71622032 missense probably damaging 1.00
R0230:Fam135b UTSW 15 71446037 missense probably benign 0.02
R0413:Fam135b UTSW 15 71463821 missense probably benign 0.45
R0524:Fam135b UTSW 15 71462284 missense probably benign 0.00
R0565:Fam135b UTSW 15 71490837 missense possibly damaging 0.88
R0628:Fam135b UTSW 15 71448656 splice site probably benign
R1415:Fam135b UTSW 15 71456928 missense probably damaging 0.99
R1462:Fam135b UTSW 15 71621996 splice site probably benign
R1701:Fam135b UTSW 15 71459729 missense probably damaging 1.00
R1797:Fam135b UTSW 15 71452441 missense probably benign 0.41
R1807:Fam135b UTSW 15 71463912 missense probably benign
R1835:Fam135b UTSW 15 71490711 missense probably damaging 1.00
R1905:Fam135b UTSW 15 71532987 missense probably damaging 1.00
R1937:Fam135b UTSW 15 71622014 missense probably damaging 1.00
R1998:Fam135b UTSW 15 71452404 missense probably damaging 0.98
R2076:Fam135b UTSW 15 71478243 missense probably damaging 0.99
R2518:Fam135b UTSW 15 71463911 missense probably benign 0.00
R3110:Fam135b UTSW 15 71464030 missense probably benign 0.05
R3112:Fam135b UTSW 15 71464030 missense probably benign 0.05
R3932:Fam135b UTSW 15 71450431 missense probably benign 0.29
R4361:Fam135b UTSW 15 71490827 missense probably damaging 1.00
R4397:Fam135b UTSW 15 71448676 missense probably benign 0.17
R4435:Fam135b UTSW 15 71448739 missense probably damaging 1.00
R4645:Fam135b UTSW 15 71462340 missense probably benign
R4740:Fam135b UTSW 15 71464071 missense probably benign 0.01
R4748:Fam135b UTSW 15 71464055 missense probably benign 0.00
R4754:Fam135b UTSW 15 71462951 missense probably benign 0.01
R5044:Fam135b UTSW 15 71462711 missense probably benign 0.02
R5617:Fam135b UTSW 15 71622016 missense probably damaging 1.00
R5642:Fam135b UTSW 15 71462136 missense probably damaging 1.00
R5778:Fam135b UTSW 15 71479032 missense probably damaging 1.00
R5891:Fam135b UTSW 15 71525803 missense probably damaging 1.00
R5958:Fam135b UTSW 15 71462895 missense probably benign 0.01
R5982:Fam135b UTSW 15 71448669 critical splice donor site probably null
R5987:Fam135b UTSW 15 71490848 missense probably benign 0.00
R6535:Fam135b UTSW 15 71622075 missense probably damaging 0.99
R6734:Fam135b UTSW 15 71462780 missense probably benign 0.02
R6887:Fam135b UTSW 15 71463315 missense probably damaging 1.00
R7028:Fam135b UTSW 15 71471563 missense probably damaging 1.00
R7035:Fam135b UTSW 15 71462253 missense possibly damaging 0.77
R7097:Fam135b UTSW 15 71622068 missense possibly damaging 0.92
R7143:Fam135b UTSW 15 71479151 missense probably benign 0.44
R7414:Fam135b UTSW 15 71478256 missense probably damaging 0.97
R7439:Fam135b UTSW 15 71463680 missense probably damaging 0.98
R7441:Fam135b UTSW 15 71463680 missense probably damaging 0.98
R7545:Fam135b UTSW 15 71450510 missense possibly damaging 0.95
R7615:Fam135b UTSW 15 71463323 missense probably damaging 1.00
R7642:Fam135b UTSW 15 71479142 missense possibly damaging 0.51
R7649:Fam135b UTSW 15 71462580 missense probably benign 0.00
R7686:Fam135b UTSW 15 71463384 missense possibly damaging 0.68
T0722:Fam135b UTSW 15 71463885 missense probably damaging 1.00
T0975:Fam135b UTSW 15 71463885 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATCTTGAGCAGCTCTGGAC -3'
(R):5'- GCATGCTAATCTTACCAACTGTAG -3'

Sequencing Primer
(F):5'- TTGAGCAGCTCTGGACAGTCAC -3'
(R):5'- GCATATTTGTATCTGCTAGTATGAGG -3'
Posted On2016-10-06