Incidental Mutation 'R5470:Nsl1'
ID433441
Institutional Source Beutler Lab
Gene Symbol Nsl1
Ensembl Gene ENSMUSG00000062510
Gene NameNSL1, MIS12 kinetochore complex component
SynonymsLOC381318, 4833432M17Rik
MMRRC Submission 043031-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #R5470 (G1)
Quality Score218
Status Validated
Chromosome1
Chromosomal Location191063012-191086474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 191080540 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 184 (M184T)
Ref Sequence ENSEMBL: ENSMUSP00000077380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078259] [ENSMUST00000139340]
Predicted Effect probably benign
Transcript: ENSMUST00000078259
AA Change: M184T

PolyPhen 2 Score 0.242 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000077380
Gene: ENSMUSG00000062510
AA Change: M184T

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:Mis14 82 197 2.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139340
SMART Domains Protein: ENSMUSP00000115289
Gene: ENSMUSG00000062510

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:Mis14 67 171 7e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192879
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two coiled-coil domains that localizes to kinetochores, which are chromosome-associated structures that attach to microtubules and mediate chromosome movements during cell division. The encoded protein is part of a conserved protein complex that includes two chromodomain-containing proteins and a component of the outer plate of the kinetochore. This protein complex is proposed to bridge centromeric heterochromatin with the outer kinetochore structure. Multiple transcript variants encoding different isoforms have been found for this gene. There is a pseudogene of the 3' UTR region of this gene on chromosome X. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 T A 12: 80,168,941 I813F probably damaging Het
Aqr G A 2: 114,157,575 L169F probably damaging Het
Atp6v1d G A 12: 78,845,284 R182C probably benign Het
Bcl2l13 G T 6: 120,862,872 A44S probably benign Het
Brip1 T C 11: 86,148,542 K389E possibly damaging Het
C530025M09Rik G A 2: 149,831,125 probably benign Het
Ccdc7b T A 8: 129,072,600 S53T possibly damaging Het
Chd8 A G 14: 52,212,609 F154L probably damaging Het
Cop1 A T 1: 159,266,860 probably benign Het
Cyp2c39 A G 19: 39,513,530 K121R possibly damaging Het
Cyp3a57 A G 5: 145,372,619 M256V probably benign Het
Deup1 T C 9: 15,582,620 probably null Het
Dnah10 A G 5: 124,753,168 N709D probably benign Het
Dthd1 A G 5: 62,818,766 Y261C probably damaging Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
En2 C T 5: 28,166,924 T133M probably benign Het
Endou A G 15: 97,718,955 F229S probably damaging Het
Etl4 A T 2: 20,529,980 H79L probably damaging Het
Fah C T 7: 84,593,185 probably null Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fignl1 T A 11: 11,802,640 E138D probably benign Het
Fndc3a A G 14: 72,574,568 L311P possibly damaging Het
Gdf9 T A 11: 53,436,754 V179E probably benign Het
Gm14129 G T 2: 148,927,817 noncoding transcript Het
Gorab A G 1: 163,392,509 I188T probably damaging Het
Gpr152 G A 19: 4,143,129 C223Y probably damaging Het
Heatr5b A T 17: 78,821,579 probably null Het
Hsd17b3 G T 13: 64,073,899 T104N probably damaging Het
Il6ra C T 3: 89,885,995 V283M probably benign Het
Klk1b16 A T 7: 44,137,331 I5F probably damaging Het
Krt74 G A 15: 101,754,465 noncoding transcript Het
Lrch3 T A 16: 32,998,590 N650K probably damaging Het
Ly96 A T 1: 16,709,486 E126D probably benign Het
Mgarp C A 3: 51,391,285 R66L possibly damaging Het
Naalad2 T A 9: 18,330,851 T586S probably damaging Het
Ndufaf3 T C 9: 108,566,444 probably benign Het
Neb A G 2: 52,249,438 M3055T possibly damaging Het
Neo1 G T 9: 58,931,067 A478D probably damaging Het
Nmrk1 A T 19: 18,639,884 probably null Het
Nup133 T C 8: 123,930,966 N410S probably benign Het
Olfr23 T C 11: 73,940,870 I208T probably benign Het
Olfr399 A G 11: 74,053,907 I284T possibly damaging Het
Olfr610 T G 7: 103,506,509 I146L probably benign Het
Opalin A G 19: 41,066,531 S75P probably benign Het
Palb2 C A 7: 122,114,351 C903F probably damaging Het
Pcm1 T A 8: 41,287,683 W989R probably damaging Het
Pfkfb4 T A 9: 109,027,593 I389N probably damaging Het
Pitrm1 T C 13: 6,553,270 C119R probably benign Het
Plekha1 T C 7: 130,908,376 V45A probably damaging Het
Pold2 G A 11: 5,873,048 P376S probably damaging Het
Rcan2 A G 17: 43,836,283 D4G probably benign Het
Slc12a1 A T 2: 125,170,714 T299S probably damaging Het
Slc22a29 A T 19: 8,161,516 H527Q probably benign Het
Slc22a8 G A 19: 8,607,870 R261H probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slco4a1 T C 2: 180,474,114 F681S probably benign Het
Sorcs2 A T 5: 36,031,183 H860Q probably benign Het
Strn A T 17: 78,656,945 H530Q probably benign Het
Tex14 A G 11: 87,551,604 R179G probably damaging Het
Tjp3 T C 10: 81,279,547 D350G probably benign Het
Tnrc6b G T 15: 80,916,711 R1406L possibly damaging Het
Tnxb A G 17: 34,716,973 D2666G probably null Het
Ttn A T 2: 76,729,864 Y27652N probably benign Het
Utp20 T A 10: 88,817,896 E287D probably benign Het
Vmn1r45 T C 6: 89,933,716 I91V probably benign Het
Wdr72 A T 9: 74,139,699 K76* probably null Het
Zfp689 C T 7: 127,444,253 A402T probably damaging Het
Zfpm1 A G 8: 122,333,793 E207G probably damaging Het
Zhx2 G T 15: 57,823,074 R613L possibly damaging Het
Other mutations in Nsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02546:Nsl1 APN 1 191071201 missense probably benign 0.06
IGL03398:Nsl1 APN 1 191082164 splice site probably benign
IGL02988:Nsl1 UTSW 1 191063103 nonsense probably null
R0054:Nsl1 UTSW 1 191082184 missense probably damaging 1.00
R0054:Nsl1 UTSW 1 191082184 missense probably damaging 1.00
R0284:Nsl1 UTSW 1 191065230 missense probably damaging 1.00
R0482:Nsl1 UTSW 1 191063040 start codon destroyed probably null 0.83
R1776:Nsl1 UTSW 1 191063188 missense probably benign
R5187:Nsl1 UTSW 1 191075190 missense probably benign 0.01
R5838:Nsl1 UTSW 1 191070113 missense probably benign 0.02
R6133:Nsl1 UTSW 1 191071206 missense probably damaging 0.99
R6636:Nsl1 UTSW 1 191075127 missense probably benign 0.00
R6817:Nsl1 UTSW 1 191063274 critical splice donor site probably null
R7755:Nsl1 UTSW 1 191063183 missense probably benign 0.21
Z1177:Nsl1 UTSW 1 191063231 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGACCAAGCTCTTAGAAAGATTAG -3'
(R):5'- ATGACCTCACTGGAGAAGCC -3'

Sequencing Primer
(F):5'- AAAGATTAGAATAAGGTGAGTTGTCC -3'
(R):5'- ACACACAGCTTCTGGGACCTG -3'
Posted On2016-10-06