Mutagenetix > Incidental Mutation

Incidental Mutation 'R5470:Aqr'

433447

Institutional Source

Beutler Lab

Gene Symbol

Aqr

Ensembl Gene

ENSMUSG00000040383

Gene Name

aquarius

Synonyms

MMRRC Submission

043031-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5470 (G1)

Quality Score

189

Status

Validated

Chromosome

Chromosomal Location

114101170-114187024 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 114157575 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 169 (L169F)

Ref Sequence

ENSEMBL: ENSMUSP00000047157 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043160] [ENSMUST00000102543]

AlphaFold

Q8CFQ3

Predicted Effect

probably damaging
Transcript: ENSMUST00000043160
AA Change: L169F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000047157
Gene: ENSMUSG00000040383
AA Change: L169F

Domain	Start	End	E-Value	Type
Pfam:Aquarius_N	18	802	N/A	PFAM
Pfam:ResIII	797	911	8.2e-7	PFAM
Pfam:AAA_11	801	1111	9.6e-32	PFAM
Pfam:AAA_19	807	894	3.7e-11	PFAM
Pfam:AAA_12	1119	1312	2.1e-27	PFAM
low complexity region	1394	1417	N/A	INTRINSIC
low complexity region	1455	1468	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102543
AA Change: L169F

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000099602
Gene: ENSMUSG00000040383
AA Change: L169F

Domain	Start	End	E-Value	Type
low complexity region	43	56	N/A	INTRINSIC
low complexity region	112	124	N/A	INTRINSIC
low complexity region	762	776	N/A	INTRINSIC
Pfam:AAA_11	801	1111	3.2e-32	PFAM
Pfam:AAA_19	807	893	6.5e-11	PFAM
Pfam:AAA_12	1119	1312	2.6e-27	PFAM
low complexity region	1348	1359	N/A	INTRINSIC
low complexity region	1371	1382	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125460

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129504

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131785

Meta Mutation Damage Score

0.1605

Coding Region Coverage

1x: 98.3%
3x: 97.3%
10x: 95.1%
20x: 90.4%

Validation Efficiency

99% (79/80)

MGI Phenotype

PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actn1	T	A	12: 80,168,941	I813F	probably damaging	Het
Atp6v1d	G	A	12: 78,845,284	R182C	probably benign	Het
Bcl2l13	G	T	6: 120,862,872	A44S	probably benign	Het
Brip1	T	C	11: 86,148,542	K389E	possibly damaging	Het
C530025M09Rik	G	A	2: 149,831,125		probably benign	Het
Ccdc7b	T	A	8: 129,072,600	S53T	possibly damaging	Het
Chd8	A	G	14: 52,212,609	F154L	probably damaging	Het
Cop1	A	T	1: 159,266,860		probably benign	Het
Cyp2c39	A	G	19: 39,513,530	K121R	possibly damaging	Het
Cyp3a57	A	G	5: 145,372,619	M256V	probably benign	Het
Deup1	T	C	9: 15,582,620		probably null	Het
Dnah10	A	G	5: 124,753,168	N709D	probably benign	Het
Dthd1	A	G	5: 62,818,766	Y261C	probably damaging	Het
Ear-ps2	G	A	14: 44,047,060		noncoding transcript	Het
En2	C	T	5: 28,166,924	T133M	probably benign	Het
Endou	A	G	15: 97,718,955	F229S	probably damaging	Het
Etl4	A	T	2: 20,529,980	H79L	probably damaging	Het
Fah	C	T	7: 84,593,185		probably null	Het
Fetub	C	T	16: 22,932,331	R143C	probably damaging	Het
Fignl1	T	A	11: 11,802,640	E138D	probably benign	Het
Fndc3a	A	G	14: 72,574,568	L311P	possibly damaging	Het
Gdf9	T	A	11: 53,436,754	V179E	probably benign	Het
Gm14129	G	T	2: 148,927,817		noncoding transcript	Het
Gorab	A	G	1: 163,392,509	I188T	probably damaging	Het
Gpr152	G	A	19: 4,143,129	C223Y	probably damaging	Het
Heatr5b	A	T	17: 78,821,579		probably null	Het
Hsd17b3	G	T	13: 64,073,899	T104N	probably damaging	Het
Il6ra	C	T	3: 89,885,995	V283M	probably benign	Het
Klk1b16	A	T	7: 44,137,331	I5F	probably damaging	Het
Krt74	G	A	15: 101,754,465		noncoding transcript	Het
Lrch3	T	A	16: 32,998,590	N650K	probably damaging	Het
Ly96	A	T	1: 16,709,486	E126D	probably benign	Het
Mgarp	C	A	3: 51,391,285	R66L	possibly damaging	Het
Naalad2	T	A	9: 18,330,851	T586S	probably damaging	Het
Ndufaf3	T	C	9: 108,566,444		probably benign	Het
Neb	A	G	2: 52,249,438	M3055T	possibly damaging	Het
Neo1	G	T	9: 58,931,067	A478D	probably damaging	Het
Nmrk1	A	T	19: 18,639,884		probably null	Het
Nsl1	T	C	1: 191,080,540	M184T	probably benign	Het
Nup133	T	C	8: 123,930,966	N410S	probably benign	Het
Olfr23	T	C	11: 73,940,870	I208T	probably benign	Het
Olfr399	A	G	11: 74,053,907	I284T	possibly damaging	Het
Olfr610	T	G	7: 103,506,509	I146L	probably benign	Het
Opalin	A	G	19: 41,066,531	S75P	probably benign	Het
Palb2	C	A	7: 122,114,351	C903F	probably damaging	Het
Pcm1	T	A	8: 41,287,683	W989R	probably damaging	Het
Pfkfb4	T	A	9: 109,027,593	I389N	probably damaging	Het
Pitrm1	T	C	13: 6,553,270	C119R	probably benign	Het
Plekha1	T	C	7: 130,908,376	V45A	probably damaging	Het
Pold2	G	A	11: 5,873,048	P376S	probably damaging	Het
Rcan2	A	G	17: 43,836,283	D4G	probably benign	Het
Slc12a1	A	T	2: 125,170,714	T299S	probably damaging	Het
Slc22a29	A	T	19: 8,161,516	H527Q	probably benign	Het
Slc22a8	G	A	19: 8,607,870	R261H	probably damaging	Het
Slc35e2	C	T	4: 155,610,026	P10L	probably benign	Het
Slco4a1	T	C	2: 180,474,114	F681S	probably benign	Het
Sorcs2	A	T	5: 36,031,183	H860Q	probably benign	Het
Strn	A	T	17: 78,656,945	H530Q	probably benign	Het
Tex14	A	G	11: 87,551,604	R179G	probably damaging	Het
Tjp3	T	C	10: 81,279,547	D350G	probably benign	Het
Tnrc6b	G	T	15: 80,916,711	R1406L	possibly damaging	Het
Tnxb	A	G	17: 34,716,973	D2666G	probably null	Het
Ttn	A	T	2: 76,729,864	Y27652N	probably benign	Het
Utp20	T	A	10: 88,817,896	E287D	probably benign	Het
Vmn1r45	T	C	6: 89,933,716	I91V	probably benign	Het
Wdr72	A	T	9: 74,139,699	K76*	probably null	Het
Zfp689	C	T	7: 127,444,253	A402T	probably damaging	Het
Zfpm1	A	G	8: 122,333,793	E207G	probably damaging	Het
Zhx2	G	T	15: 57,823,074	R613L	possibly damaging	Het

Other mutations in Aqr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Aqr	APN	2	114125942	missense	possibly damaging	0.90
IGL00694:Aqr	APN	2	114151525	missense	probably damaging	1.00
IGL02113:Aqr	APN	2	114120027	nonsense	probably null
IGL02297:Aqr	APN	2	114150481	missense	probably benign	0.24
IGL02380:Aqr	APN	2	114109936	missense	probably damaging	1.00
IGL02410:Aqr	APN	2	114136917	missense	possibly damaging	0.85
IGL02413:Aqr	APN	2	114118780	missense	possibly damaging	0.87
IGL02474:Aqr	APN	2	114112646	missense	probably damaging	1.00
IGL02941:Aqr	APN	2	114113354	missense	probably damaging	1.00
IGL02981:Aqr	APN	2	114134824	splice site	probably benign
IGL03001:Aqr	APN	2	114146919	missense	probably benign
IGL03092:Aqr	APN	2	114158943	missense	probably benign	0.38
IGL03222:Aqr	APN	2	114121256	missense	probably damaging	1.00
capricorn	UTSW	2	114105882	missense	probably damaging	1.00
Goat	UTSW	2	114157575	missense	probably damaging	1.00
Pliades	UTSW	2	114132976	missense	probably damaging	1.00
sagittarius	UTSW	2	114149016	missense	probably damaging	1.00
Zodiac	UTSW	2	114108109	missense	probably damaging	0.96
PIT4531001:Aqr	UTSW	2	114130734	missense	possibly damaging	0.94
R0103:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R0103:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R0152:Aqr	UTSW	2	114159010	missense	probably benign	0.07
R0352:Aqr	UTSW	2	114170052	missense	probably damaging	1.00
R0371:Aqr	UTSW	2	114157604	missense	possibly damaging	0.80
R0374:Aqr	UTSW	2	114130611	missense	probably damaging	1.00
R0550:Aqr	UTSW	2	114132976	missense	probably damaging	1.00
R0604:Aqr	UTSW	2	114130604	missense	probably benign	0.00
R0685:Aqr	UTSW	2	114140977	missense	probably damaging	1.00
R1236:Aqr	UTSW	2	114116655	missense	probably damaging	1.00
R1434:Aqr	UTSW	2	114150409	missense	probably damaging	1.00
R1806:Aqr	UTSW	2	114161652	missense	probably damaging	1.00
R2154:Aqr	UTSW	2	114137004	missense	probably damaging	1.00
R2185:Aqr	UTSW	2	114130534	critical splice donor site	probably null
R2377:Aqr	UTSW	2	114140940	missense	possibly damaging	0.58
R2862:Aqr	UTSW	2	114136917	missense	probably damaging	1.00
R3615:Aqr	UTSW	2	114136887	missense	probably damaging	1.00
R3616:Aqr	UTSW	2	114136887	missense	probably damaging	1.00
R3713:Aqr	UTSW	2	114118669	splice site	probably benign
R3715:Aqr	UTSW	2	114118669	splice site	probably benign
R4586:Aqr	UTSW	2	114112577	missense	probably benign	0.06
R4663:Aqr	UTSW	2	114161666	nonsense	probably null
R4809:Aqr	UTSW	2	114175214	utr 5 prime	probably benign
R4887:Aqr	UTSW	2	114150509	missense	probably damaging	1.00
R4888:Aqr	UTSW	2	114150509	missense	probably damaging	1.00
R4952:Aqr	UTSW	2	114109937	missense	probably damaging	1.00
R4974:Aqr	UTSW	2	114113351	missense	probably damaging	1.00
R5050:Aqr	UTSW	2	114112609	nonsense	probably null
R5050:Aqr	UTSW	2	114170025	critical splice donor site	probably null
R5213:Aqr	UTSW	2	114113327	missense	probably damaging	1.00
R5263:Aqr	UTSW	2	114116578	missense	probably damaging	1.00
R5488:Aqr	UTSW	2	114133073	missense	probably damaging	1.00
R5489:Aqr	UTSW	2	114133073	missense	probably damaging	1.00
R5567:Aqr	UTSW	2	114148970	missense	probably damaging	1.00
R5570:Aqr	UTSW	2	114148970	missense	probably damaging	1.00
R5641:Aqr	UTSW	2	114149034	missense	probably damaging	1.00
R5685:Aqr	UTSW	2	114156265	missense	possibly damaging	0.87
R5963:Aqr	UTSW	2	114126961	missense	probably damaging	1.00
R5992:Aqr	UTSW	2	114143049	nonsense	probably null
R6015:Aqr	UTSW	2	114175165	start codon destroyed	probably null	0.53
R6253:Aqr	UTSW	2	114156277	missense	possibly damaging	0.93
R6264:Aqr	UTSW	2	114109964	missense	probably damaging	1.00
R6773:Aqr	UTSW	2	114148996	missense	possibly damaging	0.64
R6877:Aqr	UTSW	2	114116571	nonsense	probably null
R7211:Aqr	UTSW	2	114134723	missense	probably benign	0.01
R7232:Aqr	UTSW	2	114105882	missense	probably damaging	1.00
R7308:Aqr	UTSW	2	114104062	missense	possibly damaging	0.86
R7396:Aqr	UTSW	2	114119946	nonsense	probably null
R7490:Aqr	UTSW	2	114158868	critical splice donor site	probably null
R7526:Aqr	UTSW	2	114108109	missense	probably damaging	0.96
R7629:Aqr	UTSW	2	114114593	missense	probably damaging	1.00
R7828:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R8037:Aqr	UTSW	2	114161680	missense	probably damaging	1.00
R8166:Aqr	UTSW	2	114113325	missense	possibly damaging	0.95
R8712:Aqr	UTSW	2	114118877	missense	probably damaging	1.00
R8904:Aqr	UTSW	2	114136993	missense	probably damaging	0.98
R9487:Aqr	UTSW	2	114104047	missense	probably benign	0.04
R9527:Aqr	UTSW	2	114101556	missense	probably benign	0.02
R9664:Aqr	UTSW	2	114140915	nonsense	probably null
Z1176:Aqr	UTSW	2	114108122	missense	probably damaging	0.98
Z1176:Aqr	UTSW	2	114109991	missense	probably benign	0.25

Predicted Primers

PCR Primer
(F):5'- TGTCAAAGCTCCGTTTATAGGAAG -3'
(R):5'- AGGGAGTATTCATTTGGACGTTACG -3'

Sequencing Primer
(F):5'- AAGCTCCGTTTATAGGAAGTTATTAC -3'
(R):5'- GGTCCTCACAAGGTTCATGCTAG -3'

Posted On

2016-10-06