Incidental Mutation 'R0481:Rnf13'
ID43345
Institutional Source Beutler Lab
Gene Symbol Rnf13
Ensembl Gene ENSMUSG00000036503
Gene Namering finger protein 13
Synonyms2010001H16Rik, Rzf
MMRRC Submission 038681-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0481 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location57736062-57835233 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 57807053 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 178 (L178I)
Ref Sequence ENSEMBL: ENSMUSP00000142335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041826] [ENSMUST00000197205] [ENSMUST00000198214] [ENSMUST00000198249] [ENSMUST00000199041] [ENSMUST00000200497]
Predicted Effect probably benign
Transcript: ENSMUST00000041826
AA Change: L178I

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000049331
Gene: ENSMUSG00000036503
AA Change: L178I

DomainStartEndE-ValueType
Pfam:PA 63 160 1.3e-14 PFAM
transmembrane domain 182 204 N/A INTRINSIC
low complexity region 208 226 N/A INTRINSIC
RING 240 281 1.85e-8 SMART
low complexity region 291 299 N/A INTRINSIC
low complexity region 336 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197205
SMART Domains Protein: ENSMUSP00000143692
Gene: ENSMUSG00000036503

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:PA 62 153 2.9e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197783
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197920
Predicted Effect possibly damaging
Transcript: ENSMUST00000198214
AA Change: L178I

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143498
Gene: ENSMUSG00000036503
AA Change: L178I

DomainStartEndE-ValueType
Pfam:PA 63 160 5.1e-15 PFAM
transmembrane domain 182 204 N/A INTRINSIC
low complexity region 208 226 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198249
SMART Domains Protein: ENSMUSP00000142828
Gene: ENSMUSG00000036503

DomainStartEndE-ValueType
Pfam:PA 33 131 2.5e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198996
Predicted Effect probably damaging
Transcript: ENSMUST00000199041
AA Change: L178I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142335
Gene: ENSMUSG00000036503
AA Change: L178I

DomainStartEndE-ValueType
Pfam:PA 59 162 6.6e-15 PFAM
transmembrane domain 182 204 N/A INTRINSIC
SCOP:d1ldjb_ 211 260 2e-7 SMART
Blast:RING 240 267 5e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000200497
AA Change: L178I

PolyPhen 2 Score 0.284 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000142462
Gene: ENSMUSG00000036503
AA Change: L178I

DomainStartEndE-ValueType
Pfam:PA 59 162 1.1e-14 PFAM
transmembrane domain 182 204 N/A INTRINSIC
SCOP:d1ldjb_ 211 260 1e-7 SMART
Blast:RING 240 261 9e-8 BLAST
low complexity region 262 270 N/A INTRINSIC
low complexity region 307 328 N/A INTRINSIC
Meta Mutation Damage Score 0.192 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 95% (89/94)
MGI Phenotype FUNCTION: This gene encodes a member of the PA-TM-RING family of proteins that contain a protease associated (PA) domain and a RING finger domain separated by a transmembrane (TM) domain. The encoded protein is an E3 ubiquitin ligase localized to the endosomal-lysosomal vesicles and inner nuclear membrane. Mice lacking the encoded protein have impaired learning abilities associated with a decreased synaptic vesicle density and dysregulated SNARE complex assembly. Alternative splicing of this gene results in multiple transcript variants. A pseudogene for this gene has been identified on the X chromosome. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932429P05Rik T C X: 89,752,693 S44P probably damaging Het
9530053A07Rik A T 7: 28,153,749 D1487V probably damaging Het
Abcg4 T A 9: 44,279,369 N39Y probably benign Het
Adamts10 C T 17: 33,549,373 Q840* probably null Het
Aff2 C T X: 69,834,642 T678I probably damaging Het
Ahctf1 A G 1: 179,760,271 V1418A probably benign Het
Ankrd11 G A 8: 122,900,036 R136C probably damaging Het
Arf5 A G 6: 28,426,076 Y154C probably damaging Het
AW551984 A G 9: 39,600,616 V33A probably null Het
B4galt5 A G 2: 167,309,234 L118P probably damaging Het
Bcl9l A G 9: 44,506,682 I606V probably benign Het
Bdp1 A G 13: 100,041,454 I1969T probably benign Het
Bicd1 A T 6: 149,511,891 D260V possibly damaging Het
Cap1 A T 4: 122,863,075 H272Q possibly damaging Het
Ccnk A G 12: 108,199,309 probably benign Het
Cd209f A T 8: 4,105,558 probably null Het
Cdk13 C A 13: 17,719,494 A1123S probably damaging Het
Cdx1 C T 18: 61,020,492 R158H probably damaging Het
Chd8 A G 14: 52,237,206 S123P probably benign Het
Cwc22 G A 2: 77,908,111 A497V probably damaging Het
Cwh43 T C 5: 73,418,027 S296P probably damaging Het
Dhx38 A T 8: 109,556,216 probably benign Het
Dnah5 T A 15: 28,383,599 M2989K probably benign Het
Dpy19l4 A C 4: 11,272,993 probably benign Het
F11r A T 1: 171,461,279 H155L probably benign Het
Fitm2 A G 2: 163,469,714 V193A probably benign Het
Foxk1 T A 5: 142,448,823 S281T probably benign Het
Furin A G 7: 80,393,549 C305R probably damaging Het
Fut8 T A 12: 77,448,560 V308D probably damaging Het
Gjb3 T A 4: 127,326,332 I136F probably benign Het
Glmn A T 5: 107,560,934 S385T probably benign Het
Glp1r T A 17: 30,931,217 M371K probably benign Het
Gm906 T A 13: 50,246,964 Q442L probably benign Het
Gpr179 T C 11: 97,349,718 H293R probably damaging Het
H2-M11 A T 17: 36,548,954 R280* probably null Het
Hadhb T A 5: 30,168,545 H78Q probably damaging Het
Hectd4 A G 5: 121,295,506 probably benign Het
Hexa A G 9: 59,555,410 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Hyal6 G A 6: 24,743,418 C371Y probably damaging Het
Il1rap T C 16: 26,692,835 Y210H probably damaging Het
Ino80 A T 2: 119,431,016 H722Q probably damaging Het
Kcnt1 A G 2: 25,892,496 N200S probably damaging Het
Kif27 T A 13: 58,311,264 probably benign Het
Lyst T C 13: 13,677,952 V2179A probably benign Het
Macf1 C A 4: 123,484,022 probably null Het
Mamdc4 A G 2: 25,571,216 M1T probably null Het
Mansc4 A G 6: 147,075,227 I297T possibly damaging Het
Mdn1 G A 4: 32,767,182 probably benign Het
Mib2 A G 4: 155,656,062 probably benign Het
Mon2 A G 10: 123,013,396 V1333A possibly damaging Het
Ndst2 T C 14: 20,724,468 D840G possibly damaging Het
Nell2 A T 15: 95,432,682 probably null Het
Olfr1189 A T 2: 88,592,655 I284F probably damaging Het
Olfr1301 T A 2: 111,754,585 M112K probably damaging Het
Olfr998 C A 2: 85,591,104 A188E possibly damaging Het
Pde5a C T 3: 122,818,077 probably benign Het
Phip A G 9: 82,876,716 probably benign Het
Polr2b A G 5: 77,332,082 I561V possibly damaging Het
Prkg2 A T 5: 98,994,655 probably null Het
Prl8a6 T C 13: 27,433,101 D201G probably benign Het
Ptk6 G A 2: 181,202,527 probably benign Het
Ptprn2 T C 12: 117,211,846 probably benign Het
Rdh1 G T 10: 127,763,124 R158L probably damaging Het
Rhbdl3 T C 11: 80,323,349 probably benign Het
Rims4 A T 2: 163,864,120 V198E probably damaging Het
Ripk1 T C 13: 34,009,750 S32P probably damaging Het
Slc17a5 G T 9: 78,538,302 probably null Het
Sorcs1 A G 19: 50,636,453 probably benign Het
Srpk1 G A 17: 28,590,244 probably benign Het
Stk10 A G 11: 32,614,708 K840E probably damaging Het
Suco A G 1: 161,862,313 probably benign Het
T2 G A 17: 8,417,175 probably null Het
Tbc1d5 A G 17: 50,919,051 S255P probably damaging Het
Tenm1 T C X: 42,536,181 Y2254C probably damaging Het
Tex9 T A 9: 72,478,396 K11* probably null Het
Tlr4 A G 4: 66,827,916 I29V probably benign Het
Tmem255a A T X: 38,199,646 V278D probably damaging Het
Trpc3 T C 3: 36,624,417 I840V probably benign Het
Trpm3 G A 19: 22,901,071 R622Q possibly damaging Het
Vmn1r214 T A 13: 23,035,294 Y319* probably null Het
Vmn1r53 A T 6: 90,223,718 V208E probably damaging Het
Vmn2r89 T C 14: 51,456,120 F309S probably damaging Het
Xirp2 T A 2: 67,509,909 F831L possibly damaging Het
Yes1 G T 5: 32,640,405 E23* probably null Het
Zfp292 A T 4: 34,810,059 M995K probably benign Het
Other mutations in Rnf13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:Rnf13 APN 3 57807087 missense probably benign 0.06
IGL01835:Rnf13 APN 3 57820586 missense probably damaging 1.00
IGL02219:Rnf13 APN 3 57796223 missense probably damaging 1.00
IGL02675:Rnf13 APN 3 57779396 missense probably benign 0.17
IGL03015:Rnf13 APN 3 57833744 missense possibly damaging 0.74
IGL03246:Rnf13 APN 3 57769050 missense probably damaging 0.98
R0147:Rnf13 UTSW 3 57802468 missense probably damaging 0.98
R0481:Rnf13 UTSW 3 57779451 missense probably damaging 1.00
R1389:Rnf13 UTSW 3 57779496 missense probably damaging 1.00
R2146:Rnf13 UTSW 3 57802486 missense probably null 0.99
R3964:Rnf13 UTSW 3 57769112 missense probably damaging 0.96
R4444:Rnf13 UTSW 3 57820589 missense probably damaging 1.00
R4446:Rnf13 UTSW 3 57820589 missense probably damaging 1.00
R4489:Rnf13 UTSW 3 57820589 missense probably damaging 1.00
R4810:Rnf13 UTSW 3 57796272 missense probably damaging 0.99
R4940:Rnf13 UTSW 3 57796206 missense probably damaging 0.98
R6233:Rnf13 UTSW 3 57832970 missense possibly damaging 0.83
R7002:Rnf13 UTSW 3 57833612 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- tgtcctctctccagcctcAGACT -3'
(R):5'- CTCCAGTTCCCATGCACAATAAATGTTC -3'

Sequencing Primer
(F):5'- ctcaactttcctaatgctgcc -3'
(R):5'- CCCATGCACAATAAATGTTCTTTCAG -3'
Posted On2013-05-23